Editorial


Exploration and Understanding of Beneficial Properties of Lactic Acid Bacteria: 10 years of experience in Applied Food Biotechnology

Svetoslav Dimitrov Todorov, Richard Weeks, Kianoush Khosravi-Darani, Michail Leonidas Chikindas

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e1
https://doi.org/10.22037/afb.v11i1.43665

The scientific community is currently facing a more than exponential increase of knowledge in all areas and disciplines. In the last 10 years, the contribution of the journal Applied Food Biotechnology was eminent in distributing that knowledge by providing a tribune for researchers from different countries all over the world to share their ideas, observations, and hypotheses. With a focus on different aspects of applied and fundamental biological sciences, the journal Applied Food Biotechnology was established as a reference of the Iranian scientific community. In the last 10 years, the journal has been covering several topics related to exploring the beneficial properties of lactic acid bacteria (LAB) and their role in modern food technologies. LAB are already proven as a realization of Hippocrates' vision for the potential role of food in human and other animals' health. However, what will be the next frontier? What are the challenges in understanding the interactions between microbiota and host microorganisms? What will be the novel analytical tools, facilitating a new era of probiotic research? These were only a few research topics presented and discussed in Applied Food Biotechnology in the last decade. This editorial overview aims to celebrate the scientific contribution of Applied Food Biotechnology in the area of research associated with the beneficial properties of LAB, summarizing some of the studies published in the journal.

In this editorial article, nationality of the authors from establishment of Applied Food Biotechnology from 2014 to the present time has been overviewed. The editorial board, especially chief editor, wish to make a broad global audience to spread knowledge of food biotechnology via publication of outstanding articles in this journal. At the beginning of the activity of journal office, a limited number of non-Iranian authors submitted their manuscripts to this journal; however immediately after the publication of the first issue, number of the foreign authors increased further, while they showed their satisfaction with the acceleration in peer-review processes of their manuscripts. From the published articles, probiotics has been the major scope; therefore, screening of the beneficial probiotics from various natural sources and their uses in prevention of diseases have been introduced by various authors. Thus, the most interesting findings of the authors have been introduced; through which, readers are further adapted to the journal priorities and preferences in probiotics and postbiotics. It is believed that invitation of prestigious authors and carrying out rapid peer-review processes are a key success to achieve high article citations and authors’ satisfactions.

Plants Extract and Essential Oil as Natural Preservatives in Foods: One-Decade Editorial Experiences

Khadijeh Khoshtinat, Zahra Beig Mohammadi

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e13
https://doi.org/10.22037/afb.v11i1.44605

The researchers are fronting the increasing of knowledge in extraction, application, and also antioxidant and antimicrobial properties of plant extracts and essential oils. In recent decade, the journal "Applied Food Biotechnology" has been established a channel for scientists all around the world to share their own hypotheses, results, and conclusions. As a peer-reviewed multi-disciplinary biotechnological publication, it covers several scopes which one important one is food microbiology. In this context, the journal has published several reports on food application of plant extracts and essential oils. The aim of this text is to determine the main categories of published articles in this context in the Journal of "Applied Food Biotechnology" and so on by editors. It seems that research tend to show the effective function of essential oils, as well as comparison of free and encapsulated forms as antimicrobial and antioxidant agents in food. With the aim of holding the potential to alleviate certain complexities, enhance yield, and simplify the isolation process of bioactive metabolites or their individual components, research has played a significant role in reducing production cost of essential oil and herbal extract.

Background and Objective: In 2014, the first issue of Applied Food Biotechnology was launched. In 2024, the journal celebrates its tenth anniversary. As an editorial board member of the journal, I take the opportunity to appreciate this jubilee by reflecting articles published in this journal at the intersection of the food chain and biotechnological production of polyhydroxyalkanoates biopolyesters, which are sustainable and intrinsically natural alternatives to conventional plastics. Polyhydroxyalkanoates are biodegradable polymers produced via microbial cultivation, predominantly resorting to heterotrophic substrates. As an increasing trend, polyhydroxyalkanoates are produced from various food and agro-industrial byproducts, which can be upgraded to raw biotechnological materials.

Results and Conclusion: The present publication addressed the multifaceted role of food chain as a source of raw materials (carbon feedstocks) for polyhydroxyalkanoates production, a provider of organic filler materials to enhance characteristics of polyhydroxyalkanoates and a target for the use of these biopolyesters in food packaging. Based on previous contributions to Applied Food Biotechnology, the manuscript assesses environmental and economic implications of integrating polyhydroxyalkanoates production within the food chain, highlighting the potential to decrease food-industrial wastes, carbon footprints and coproduction of polyhydroxyalkanoates and additional valued bioproducts. This includes challenges associated to scaling up polyhydroxyalkanoates production such as feedstock availability, production costs and market acceptance. By analyzing current advancements and case studies previously published in Applied Food Biotechnology, this editorial paper provides insights into how polyhydroxyalkanoates biopolyesters could effectively be integrated into existing food supply chains, potentially transforming waste streams into value-added bioproducts. Presented publications suggested that if appropriate technological and policy supports provided, polyhydroxyalkanoates could play a critical role in enhancing sustainability of the plastics industry and global food safety.

  1. Introduction

 

Microbial polyhydroxyalkanoate polyesters (PHA) are interesting biomaterials due to their intrinsically natural characteristics [1]. Their production is embedded into the patterns of circular economy and matches targets of the UN Sustainable Development Goals [2] and Principles of Green Chemistry [3]. Although PHA is still underrepresented in the biopolymer market for quantity, it is currently experiencing “a new wave of industrialization” with a rapid increase in annual growth rates [4]. Being biobased (based on renewable resources), biosynthesized (produced in vivo by the intracellular biocatalytic toolbox of living organisms), biocompatible (no known threats of PHA to nature and its organisms) and biodegradable (complete disintegration into the original starting materials CO2 and water by the action of living organisms in diverse environments) makes PHAs the “future green materials of choice” when it comes to substituting end-of-pipe petroplastics in various fields of uses [5,6]. These uses predominately encompass single-use plastics such as packaging materials, drinking straws or cutlery. Furthermore, high-end uses in various industries are addressed, including agriculture, aquaculture and biomedicine [4]. At a first glance, it might not be trivial for non-experts to figure out how PHA biopolyesters and the food chain could be interrelated. How are “bioplastics” linked to human nutrition and hence to foods and feeds? Why are these materials interested by a scientific journal such as Applied Food Biotechnology? In fact, there are several connections between these areas as follows:

  1. First, the biobased nature of PHA biopolyesters needs appropriate carbon sources for their production [1]. It was established for decades to carry out heterotrophic PHA production based on such carbon sources, which play roles in food and feed productions. Carbohydrates such as starch, sucrose and edible oils are typically served as feedstocks for PHA production; thus, conflicting with food safety and consuming land areas. This, of course, provokes ethical conflicts such as the “plate versus plastic” controversy. It was not before the late 1990s and early 2000s, when a paradigm shift in the scientific community occurred. Researchers started to replace such nutritionally important materials with the second generation feedstocks and hence organic wastes and surplus materials [7–9]. The first important connection between the PHA and food chain becomes visible. Agroindustry and the food processing industry generate numerous organic side products that can be used as feedstocks for biotechnological purposes such as PHA production instead of being disposed. This can occur either directly or after converting these typically complex materials to accessible carbon sources via appropriate upstream processing strategies. Moreover, optimization strategies to adapt the cultivation media to such novel feedstocks is necessary [10]. Prime examples include use of waste cooking and frying oils [11,12], surplus whey from dairy industries [13], molasses and other sugar and candy industrial waste streams [14–16], bakery wastes [17], wastes from rice production [18], fruit wastes [19,20], oils extracted from and hydrolysates of spent coffee grounds [21–23], crude glycerol from biodiesel production based on waste cooking oil or slaughtering wastes [24] or low-quality biodiesel fractions originating from animal processing [25]. Personally, the author of this article worked for several years on this topic. As a PhD student, the author was engaged in the EU-FP5 project WHEYPOL (2001–2004), where lactose-rich waste streams from dairy industries were used for PHA production (https://online.tugraz.at/tug_online/pl/ui/$ctx/fdb_detail.ansicht?cvfanr=F12277&cvorgnr=37&v_proces=8&sprache=2). Later, the author coordinated the EU-FP7 project ANIMPOL (2010–2012), which studied the biotechnological conversion of carbon-containing waste streams from the animal processing industries for eco-efficient production of high added PHA biopolyesters (https://cordis.europa.eu/project/id/245084/results).
  2. Food packaging, which serves for storage, transportation and commercialization of foods, needing appropriate packaging materials. Food packaging is typically based on petrochemical plastics due to their inherent benefits such as low density, transparency and high barrier against oxygen, water vapor, CO2 and UV. Moreover, the customers expect that such packaging materials act as barriers for essential food flavors. In food packaging uses, high oxygen and water vapor barriers (gas barriers) are the most important prerequisite for preserving quality of the products throughout their entire life cycle. Quantities of oxygen and CO2, gas atmosphere in the packaging and respiration rates (gas mass transfer) of the packaging must be addressed to optimally preserve the packaged foods. Variations in color, taste and smell, oxidation of lipids, formation of microorganisms and damages to nutrients need to be avoided [26].

Packaging, especially in the food sector, should not only be biological such as bio-based and biodegradable (compostable), but should include a similar or improved performance to established packaging materials. Based on petrochemical established plastics, these are expected to outperform established packaging materials [27]. To meet these requirements, the packaging industry often uses expensive multilayer co-extruded or laminated plastic films to combine the respective techno-functional characteristics of various polymers [28]. This means that food packaging is often high technology. Established polymer films used for food packaging frequently consist of ethylene vinyl alcohol (EVOH) copolymers as one layer to create a sufficient oxygen barrier (important to avoid aerobic perishing of foods). However, such polymers used for these uses are petroleum-based (not biobased) and their combination with other polymers in various layers damages recyclability since monomaterials (e.g., EVOH) with high purity are needed for reprocessing (recycling) [29]. As an emerging trend, we witness an increasing number of studies substituting petrochemical food packaging such as EVOH by natural alternatives. A prime example includes whey protein-based films for food packaging. Whey retentate protein coating can extend the shelf life of foods due to its high barrier characteristics against gases such as oxygen [30]. Future developments should focus on use of packaging carrier layers made of PHA (biotechnologically produced from whey permeate, a surplus product of foods, dairies and industries), which includes poorer gas barrier characteristics but is water-repellent (PHA is hydrophobic) and another layer of whey protein film (high gas barrier, but more hydrophilic than PHA) on top. Moreover, it should be studied if another sealing layer of PHA adds further benefits to such novel food packaging materials. Thus, a surplus material of food production, whey, serves as a food packaging material.

Combining PHA films with filler materials of agro-industrial origin to design smart and functional food packaging materials is a novel idea. This was exemplified by Kovalcik and colleagues, who combined the microbial biopolyester PHA poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)] with lignin, an agricultural surplus product from corn, rice or cane sugar production via thermoforming to develop novel composite materials for packaging purposes. After assessing compatibility of the two raw materials, deep-drawn (thermoformed) composite specimens were assessed for effects of the lignin fraction (0–10 wt%) on melting and crystallization behaviors, thermo-oxidative stability and mechanical and viscoelastic (how elastic or crystalline is the material) characteristics and to assess their permeability or barrier for oxygen and CO2. The incorporated lignin was highly compatible with the bulk materials used (microbial PHA) and acted as an active additive through reinforcing effects (better tensile strength; improvement of viscoelastic characteristics). As intended, gas permeability decreased by combining PHA with 1 wt% lignin. Moreover, permeability decreased by 77% for oxygen and by 91% for CO2, compared to native PHA biopolyester samples. In addition, the low thermo-oxidation stability, a typical characteristic of pure PHA, increased for the lignin-containing materials. The first report on thermoformed composite materials of microbial poly(3HB-co-3HV) and lignin introduced a new class of bio-based polymer materials that could further be used for the packaging of various perishable goods [31]. The subsequent section summarizes previous contributions to Applied Food Biotechnology, which draw a holistic picture of the interrelations between PHA biopolyesters and the food chain.

  1. Individual Contributions

2.1. Contribution 1. Poly(hydroxyalkanoates) for Food Packaging: Uses and Attempts towards Implementation

This review article, published as the first one in the journal first issue, summarized the facts making PHA biopolyesters promising materials able to compete with petrochemical plastics in the food packaging sector. The article addressed shortcomings in specific aspects of PHA material performance and highlighted economic factors of their biosynthesis and purification as existing hurdles on the way towards the market penetration of PHA for food packaging. The review discussed advantages and drawbacks of PHAs as food packaging materials and provided examples on how PHA material characteristics could be upgraded by developing novel composite materials. This included use of nanoparticles of diverse origins to create novel nanocomposites with tailored gas permeation behaviors [32].

 

2.2. Contribution 2. Principles of Glycerol-based Polyhydroxyalkanoate Production

Glycerol-based PHA production and challenges of using crude glycerol as a feedstock in biotechnology were addressed in this review article, which shed light on the metabolic background of PHA production using glycerol as a carbon source. Particularities of glycerol-based PHA biosynthesis were discussed as well. This included effects of inhibitors present in crude glycerol stemming from the biodiesel production process, calling for purification steps of the raw materials. Moreover, biosynthesis of PHA with typically low-molecular mass when using glycerol as carbon source and resulting effects of such low-molecular mass on polymer processing and characteristics were discussed [33].

 

2.3. Contribution 3. Potential of Diverse Prokaryotic Organisms for Glycerol-based Polyhydroxyalkanoate Production

As previously stated, glycerol is a major product of biodiesel production, which in turn is based on waste materials of gastronomy, namely waste cooking oil, or on waste lipids from rendering and slaughtering industries. The contribution collected available studies describing the performance of various bacterial and haloarchaeal wild-type species, mixed microbial cultures and presented studies on the use of genetically engineered organisms as production strains for glycerol-based PHA biosynthesis. Therefore, this article dived deeply into microbiology. Kinetic data for microbial growth and PHA accumulation, thermo-mechanical characteristics of recovered glycerol-based PHA samples and mathematical models established by various research teams to describe glycerol-based PHA production were included in this review article, providing an overview of the state of knowledge at that time also providing an outlook to expected developments [34].

 

2.4. Contribution 4. Optimal Medium Composition to Enhance Poly-β-hydroxybutyrate Production by Ralstonia eutropha Using Cane Molasses as Sole Carbon Source

Bozorg and colleagues studied growth and poly(3-hydroxybutyrate) [P(3HB)] biosynthesis using Cupriavidus necator, previously classified as Ralstonia eutropha, on various inexpensive, abundant carbon sources. Carbon sources were originated from food and feed industries and included sugar cane molasses, beet molasses, soya bean waste and corn steep liquor. Authors used batch cultivation setups for their experiments. Using sugar cane molasses resulted in production of 0.49 g∙l-1 P(3HB), which made this surplus material the most efficient carbon source within all the assessed materials for the production strain. To improve biomass growth and P(3HB) biosynthesis, cane molasses was pretreated variously. Using sulfuric acid to remove heavy metals and suspended impurities resulted in enhancements in P(3HB) production of 33%. Additionally, urea and corn steep liquor were used as sources of nitrogen, minerals and vitamins. Composition of the molasses-based cultivation media was optimized using response surface methodology and 2n-factorial central composite design, resulting in maximum biomass and P(3HB) concentration of 5.03 and 1.63 g∙l-1, respectively [35].

 

2.5. Contribution 5. Study on the Effects of Levulinic Acid on Whey-based Biosynthesis of Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by Hydrogenophaga pseudoflava

This experimental study described production of PHA copolyesters consisting of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV) monomers and hence P(3HB-co-3HV). For the first time, bacterial strain of Hydrogenophaga pseudoflava was used for P(3HB-co-3HV) production based on a novel substrate/co-substrate combination. While whey permeate from dairy industry was used as the major carbon source for biosynthesis of catalytically active biomass and 3HB, levulinic acid, originating from the chemical conversion of lignocellulosic feedstocks of agricultural origin, was used as a precursor compound structurally linked to 3HV, allowing for PHA copolyester production. This strategy aimed at increased cost efficiency in P(3HB-co-3HV) production, together with enhanced material quality of P(3HB-co-3HV), compared to highly crystalline P(3HB) homopolyester. It was shown that during nutritionally balanced growth of H. pseudoflava, levulinic acid drastically inhibited microbial growth at rather low concentrations of 0.2 g∙l-1; the growth inhibition constant Ki was assessed as 0.032. This suggested that this compound needed a careful supply at a low dosage during the first cultivation phase. Under nitrogen-limited cultivation conditions, strain inhibition by levulinic acid was less significant. The P(3HB-co-3HV) concentrations and volumetric productivities up to 4.2 g∙l-1 and 0.06 g∙l-1 h-1, respectively, were reached in dependence on levulinic acid supply. Moreover, P(3HB-co-3HV) composition when feeding mixtures of various whey/levulinic acid ratios revealed 3HV fractions in the co-polyester of 0–0.6 mol.mol-1. This study provided a proof-of-concept for the feasibility of combined uses of various waste and surplus materials from food and agro-industry for the generation of PHA biopolyesters with enhanced material characteristics [36].

 

2.6. Contribution 6. Waste Streams of the Animal-processing Industry as Feedstocks to Produce Polyhydroxyalkanoate Biopolyesters

The European animal processing industry, which includes slaughterhouses, rendering industry and sausage and ham productions, produces enormous quantities of organic side streams, which contain nearly 500,000 t of lipids in addition to substantial quantities of offal materials plus meats and bone meals. Value-adding strategies to use and upgrade these waste materials are needed, for example, for PHA production. The review article collected previous and current studies using these animal-based waste streams for PHA production, selected microbial production strains, diverse upstream processing techniques to generate accessible carbon sources from the raw materials, kinetics for growth and product formation, characterization of the produced PHA biopolyesters, environmental process analysis and economic feasibility of the new processes. Compared case studies provided evidence that use of animal processing wastes as inexpensive feedstocks for PHA production could definitely become economically viable, provided the use of optimized production strains, optimized cultivation regimes, short transportation distances for the raw materials and clear plans for use and commercialization of the produced biopolyesters [37].

Special issue

In 2019, increasing studies and development activities on PHA biopolyesters with context to the food chain provided reasons to launch a special issue of the journal, dedicated to the topic “Linking Food Industry to “Green Plastics” – Polyhydroxyalkanoate (PHA) Biopolyesters from Agro-industrial Byproducts for Securing Food Safety” [Applied Food Biotechnology 6(2), 2019], which was introduced by a key editorial article [38]. Indeed, the special issue motivated a total of eight various authorships worldwide to contribute their recent scientific results on the topic. The individual contributions are present in the following paragraphs.

 

2.7. Contribution 7. The Potential of Polyhydroxyalkanoate Production from Food Wastes

Brigham and Riedel provided a comprehensive review on the use of underused food wastes of various origin for PHA production. Background of this article included an enormous quantity of more than 1 billion tons of foods wasted year by year, which was not consumed by humans or animals and needed disposal, mostly by dumping in landfills or composting. Therefore, authors addressed an attractive idea of using such organic wastes as carbon sources for cultivation of value-added products, such as PHA biopolyesters. The review showed that wild type and engineered microbial strains could be used to efficiently convert food-derived waste streams to PHA. Generated PHA biopolyesters, depending on the monomeric composition, could have various thermal and mechanical characteristics, which in turn were useful for various technical uses. Importantly, as the take-home-message of the article, PHA production facilities needed establishment closely to sites where food waste accumulate, such as next to large landfills and food processing factories to save transportation costs [39].

 

2.8. Contribution 8. The Potential Application of Cupriavidus necator as Polyhydroxyalkanoates Producer and Single Cell Protein: A Review on Scientific, Cultural and Religious Perspectives

Chee et al. addressed the fact that conversion of byproducts from the food and agricultural industries provided an attractive strategy to minimize and upgrade wastes. In the article, they combined use of the C. necator strain as cell factory for PHA production and, based on its chemical composition, as a nutritional food or feed source. It was known for a long time that C. necator, owing to its high protein content, could be used as a source of single cell protein (SCP) for animal feed. When fed with PHA-rich C. necator biomass, larvae of the mealworm beetle (Tenebrio molitor) were shown to efficiently digest the non-PHA C. necator part of biomass as a source of protein, while excreting PHA granules in a highly pure form and thus providing an intrinsically biologically methods for PHA recovery. This review focused on the nutritional value of C. necator as a SCP source and associated safety aspects when used as animal feed. The novel combination of using byproducts from the agriculture and food industries as carbon feedstocks to produce SCP and PHA biopolyesters with the follow-up use of the SCP to cultivate T. molitor larvae was discussed with the public acceptance of using SCP and T. molitor biomass as food sources for human nutrition, depending on the global regions and cultural conditions [40].

 

2.9. Contribution 9. Biocomposites Based on Polyhydroxyalkanoates and Natural Fibers from Renewable Byproducts

Cinelli and colleagues used PHA biopolyesters and natural fibers as fillers for the generation of biobased composites. This approach attracted attentions from various end users from the packaging sector to producers of automotive components. In their article, authors produced biobased composites using compostable PHA biopolyesters plus natural fibers or fillers derived by wood industry and food wastes, namely legumes byproducts. P(3HB-co-3HV) copolyesters were processed with biobased and biodegradable plasticizers such as acetyl tributyl citrate and calcium carbonate as inorganic fillers. Variable quantities of natural fibers were added to the polymeric matrix for the production of composites. These green biocomposites were produced through melt extrusion and injection molding. Characterization of the novel composites was accomplished via thermal, rheological, mechanical and morphological studies. It was shown that characteristics of the generated biocomposites were fit with the requirements for the production of rigid food packaging materials, as well as other single use plastic items. Thus, the proof-of-concept for a new way of valorization of food residues was provided [41].

 

2.10. Contribution 10. Bacterial Production of PHAs from Lipid-rich Byproducts

Favaro and colleagues assessed potential of various lipid-rich side streams as biotechnological substrates such as crude glycerol from biodiesel manufacturing, low-quality biodiesel achieved from fatty waste streams of animal origin and inexpensive bacon rind, udder and tallow from slaughterhouses. Several new microbial isolates and PHA-producing microbes from strain collections were screened for their lipolytic activities needed to convert lipid-rich substrates and their capability for PHA production. In the context of isolation of new strains, interesting microbial species were isolated from soil. These strains were superior to strains isolated from further specific and selective sampling sites such as slaughterhouses. Significantly, two PHA production strains from the collections, C. necator DSM 545 and Pseudomonas oleovorans DSM 1045, were definitely promising. They were able to grow directly on all the lipid-rich substrates and produced various quantities of PHA biopolyesters, P(3HB) homopolyester and P(3HB-co-3HV) copolyesters [42].

 

2.11. Contribution 11. Paracoccus sp. Strain LL1 as a Single Cell Factory for the Conversion of Waste Cooking Oil to Polyhydroxyalkanoates and Carotenoids

Kumar and Kim addressed the fact that co-generation of other value-added bioproducts in addition to PHA by a similar microbial production strain during a similar cultivation cycle could help decrease the overall PHA production costs by up to 50%. For the first time, it was shown that PHA and carotenoids (especially astaxanthin that is important for aquaculture, especially farming of salmons and trout) could be produced in parallel by the halophilic Gram-negative strain of Paracoccus sp. LL1 using waste cooking oil as a food waste-derived carbon source. Paracoccus sp. LL1 was grown through batch cultivation mode in a defined mineral medium containing 1 vol% waste cooking oil. Various surfactants were used as emulsifiers to facilitate substrate utilization by the cells. Recovered PHA was characterized by fluorescent microscopy imaging, Fourier transform infra-red spectroscopy (FT-IR) and gas chromatography (GC). Used as a carbon source, waste cooking oil led to 1.0 g∙l-1 P(3HB-co-3HV) copolyester production with biosynthesis of 0.89 mg∙l-1 of carotenoids after a cultivation time of 96 h. Cell dry mass increased 2.7-fold when 0.1 vol% Tween-80 was used as emulsifier to enhance lipid distribution in the aqueous phase. It was shown for the first time that Paracoccus sp. LL1 constituted an auspicious candidate as a single cell factory for the bioconversion of inexpensive, food-related surplus materials into value-added bioproducts [43].

2.12. Contribution 12. Camelina Oil as a Promising Substrate for mcl-PHA Production in Pseudomonas sp. Cultures

Bustamante and colleagues studied production of medium-chain-length polyhydroxyalkanoates (mcl-PHA), which constituted PHA biopolyesters with building blocks of more than five carbon atoms, in contrast to short-chain-length PHA (scl-PHA) such as P(3HB) and P(3HB-co-3HV). These mcl-PHA biopolyesters included intriguing material characteristics, making them interesting as elastic and sticky specialty biopolymers, which could be used for example as adhesives. Previously, mcl-PHA producers from the Pseudomonas genus revealed high substrate-to-product conversion yields on lipids. Relatively, the lipid-rich plant of Camelina sativa is a non-food crop that does not compete with human nutrition; however, its seeds contain nearly 43 wt% (w.w-1) oil in dry matter, nearly 90% thereof are unsaturated fatty acids. In this study, camelina oil was first assessed as a substrate for the production of mcl-PHA by various strains of Pseudomonas spp. Moreover, PHA production was studied in a nitrogen-limited media supplemented with crude or saponified camelina oil. Under phosphate-limited conditions, PHA production was optimized in fed-batch cultivation setups. Pseudomonas resinovorans DSM 21078, the most auspicious organisms, was used for direct conversion of camelina oil without prior saponification. On bioreactor scale, a mcl-PHA content of up to 40 wt% was achieved, which was in a similar range as the highest mcl-PHA production for this strain using edible plant oils, quantifying to 13.2 g∙l-1. To conclude, camelina oil was a viable carbon source for mcl-PHA production without the need of excessive upstream processing to pretreat the raw materials such as saponification or hydrolysis [44].

 

2.13. Contribution 13. Production of Medium-Chain Length Polyhydroxyalkanoates by Pseudomonas citronellolis Grown in Apple Pulp Waste

Rebocho and colleagues provided an additional study on mcl-PHA production based on food-industrial byproducts. Apple pulp waste from the fruit processing industry, a sugar-rich waste material with high potential as a feedstock for the production of value-added bioproducts, was used as a carbon source. Moreover, Pseudomonas citronellolis NRRL B-2504 was used as production strain for biosynthesis of natural mcl-PHA elastomers, which included characteristics of “biolatex”. Technically, solid apple-pulp waste fraction was removed, while the soluble fraction rich in fructose (17.7 g∙l-1), glucose (7.5 g∙l-1) and sucrose (1.2 g∙l-1) was used in laboratory-scale bioreactor cultivation of the strain P. citronellolis NRRL B-2504 in batch mode. The strain reached a mcl-PHA fraction in dry biomass of 30 wt% and a volumetric productivity for mcl-PHA of 0.025 g.l-1 h-1. Product (mcl-PHA) predominantly consisted of 3-hydroxydecanoate (3HD; 68% mol) and 3-hydroxyoctanoate (3HO; 22% mol) with low contents of 3-hydroxydodecanoate (3HDD; 5% mol), 3-hydroxytetradecanoate (3HTD; 4% mol) and 3-hydroxyhexanoate (3HHx; 1% mol). The molecular mass was reported as 3.7 × 105 Da. Furthermore, DSC assessment revealed a glass transition (Tg) and melting temperature(Tm) of -12 and 53 °C, respectively, as typical values for mcl-PHA, and an onset of thermal degradation temperature (Td) of 296 °C. The Mcl-PHA films were prepared via a solvent-casting technique. These were translucid, colorless, flexible, dense, ductile and permeable to O2 and CO2. Moreover, mechanical characteristics of the films (tensile strength and elongation at break) and the water contact angle were assessed in this study. Mechanical characteristics were in a similar range for other mcl-PHA samples previously assessed while the water contact angle, a measure for surface hydrophobicity and surface constitution, was similar to values reported for natural rubbers. To conclude, apple pulp waste seemed an appropriate carbon source for mcl-PHA production and produced mcl-PHA samples demonstrated characteristics that made them promising alternatives to polymers from petrochemistry [45].

 

2.14. Contribution 14. Interconnection of Waste Chicken Feather Biodegradation and Keratinase and mcl-PHA Production Using Pseudomonas putida KT2440

Pernicova and colleagues upgraded a definitely underinvestigated waste raw material to a biotechnological substrate. Waste chicken feathers, deriving from poultry processing industry is annually produced at high quantities in numerous countries and these enormous quantities deserve innovative disposal strategies. Authors of the study used Pseudomonas putida KT2440 (DSM 6125), a microorganism capable of converting chicken feathers as its sole carbon substrate, for biodegradation of feathers. This was possible due to hydrolytic enzyme of keratinase excreted by the strain. Keratinase can conveniently be isolated after biodegradation of feathers and represents a significant byproduct of the presented technology. In addition, microbial culture of P. putida KT2440 is capable of mcl-PHA biosynthesis. Briefly, P. putida KT2440 was cultured for 7 d in presence of waste chicken feathers as the sole carbon source. During the cultivation process, activity of keratinase and bacterial growth were monitored. After the cultivation, biocatalytically active microbial biomass generated during feather degradation was recovered via filtration and then used for mcl-PHA production. Waste cooking oil, the second food-derived waste material used in the study, was referred as a sole carbon source. During the biodegradation of waste chicken feathers, bacterial cells did not produce significant quantities of mcl-PHA. After feather biodegradation when active bacterial cells were transferred into a nitrogen-deprived defined mineral medium containing waste cooking oil, a high mcl-PHA content of 61% of the bacterial cell dry mass was achieved. The accumulated mcl-PHA consisted of 3HHx (27.2 mol%) and 3HO (72.8 mol%) monomeric building blocks. This study demonstrated for the very first time possible connection of using waste chicken feathers with bioproduction of keratinase, an industrially important enzyme and mcl-PHA elastomers based on waste cooking oil, a food-industrial surplus product [46].

 

Articles published after the special issue

 

2.15. Contribution 15. Assessing Feasibility of Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) Co-biopolymer Production from Rice Wastewater by Azohydromonas lata

Amini et al. used starchy rice wastewater for the production of PHA by the bacterial strain of Azohydromonas lata DSM 1123 in batch cultivation setups. Rice wastewater is known for its high biochemical and chemical oxygen demands and organic loads, majorly in form of starch. This causes serious environmental concerns. In this study, it was shown that rice wastewater could potentially be used as a low-cost substrate for PHA biopolyester production. First, Aspergillus niger fungus was used to hydrolyze starch dissolved in rice wastewater to fermentable soluble sugars (glucose and maltose). Second, A. lata was cultured in wastewater containing hydrolyzed starch at various C:N:P ratios to study PHA biosynthesis. Third, effects of various nitrogen (ammonium sulphate, ammonium nitrate, ammonium chloride and urea) and carbon sources (hydrolyzed rice wastewater, wastewater plus acetate and wastewater plus butyrate) on PHA biosynthesis were assessed at a fixed C:N:P ratio of 100:4:1. This study showed that A. lata was able to accumulate PHA from starchy rice wastewater in presence of simple carbon sources under limited nutrient conditions, especially phosphate. The highest PHA fraction in biomass was achieved when ammonium sulphate was used as a nitrogen source. The highest recorded cell dry mass and PHA concentration were respectively reported as 4.64 and 2.8 g∙l-1 at a PHA content in biomass of 60 wt%. Results indicated that phosphate and nitrogen limitations significantly affected PHA biosynthesis and rice wastewater constituted a potential alternative carbon source for PHA production [47].

2.16. Contribution 16. A Strategic Review on Use of Polyhydroxyalkanoates as an Immunostimulant in Aquaculture

In this review article, Santosh and Umesh addressed the increasing concerns on the excessive use of antibiotics in aquaculture. As an alternative to established antibiotics, studies currently focus on the use of short chain fatty acids and other biocompatible molecules for prophylaxis and treatment of diseases affecting aquatic species. As rather new field of PHA biopolyesters use associated to food production, they demonstrated antimicrobial activity, contributing to the success of aquaculture. Until recent years, only a little attention was dedicated to the use of microbial PHA as antimicrobial compounds in aquaculture. However, studies of PHA co-fed with fish fodders in aquaculture have substantiated their auspicious roles as ecologically benign alternatives for commercially available established antibiotics with strong immunomodulatory effects in fish and crustacea. Further effects of PHA supplementation included higher survival rates for mussels and increased development rates and stress resistance for crabs. Data from these studies were provided in this review

article. It was shown that this research field currently witnessed a dynamic development due to PHA promising immunomodulatory and antimicrobial activity against widespread pathogens in aquaculture. Despite the fact that a range of hypothesis and research data sets are available for explaining the mechanisms underlying the immunostimulatory effects of PHA biopolyesters, genetic and molecular bases of these phenomena still need in-depth investigations [48].

 

  1. Conclusion

It has been shown that biotechnologically produced PHA biopolyesters and food chain are strongly interrelated on several levels, including level of using organic wastes from food production and processing as biotechnological carbon source that provides a solution for waste disposal problems, level of PHA-based food packaging and level of enhancing material characteristics of PHA using food industry-derived additives and fillers. An additional level recently accrued as use of PHA as immunostimulants and novel antimicrobials in aquaculture. All these levels contribute to enhancement of security in food production, storage and commercialization. It is clear that several sectors are faced new challenges in future, including food and agroindustry (“Is waste really waste?”), waste disposal sector (separation of waste streams as cleanly as possible, preferably on site), packaging sector (development, design and market introduction of new materials) and recycling sector (adaptation to new materials with biodegradability). In general, PHA biopolyesters can be addressed as green materials of choice when upgrading food industry wastes and designing smart food packaging materials. The scientific community and the society uniformly can expect dynamic progresses in the further intertwining of these two fields, food and green plastics, which are entangled much closer than expected a priori.

  1. Acknowledgements

The author thanks the Editor-in-Chief for the invitation to prepare this editorial manuscript.

  1. Conflict of Interest

The author reports no conflict of interest.

  1. Authors Contributions

MK was the sole author.

  1. Using Artificial Intelligent chatbots

Artificial intelligent chatbots were not used.

References

  1. Mukherjee A, Koller M. Microbial PolyHydroxyAlkanoate (PHA) biopolymers—Intrinsically natural. Bioengineering 2023; 10 (7): 855.

https://doi.org/10.3390/bioengineering10070855

  1. Mukherjee A, Koller M. Polyhydroxyalkanoate (PHA) bio-polyesters – circular materials for sustainable development and growth. Chem Biochem Eng Q 2022; 36 (4): 273-293.

https://doi.org/10.15255/CABEQ.2022.2124

  1. Mukherjee A, Koller M. Polyhydroxyalkanoate (PHA) biopolyesters-emerging and major products of industrial biotechnology. The EuroBiotech Journal 2022; 6 (2): 49-60.

https://doi.org/10.2478/ebtj-2022-0007

  1. Koller M, Mukherjee A. A new wave of industrialization of PHA biopolyesters. Bioengineering 2022; 9 (2): 74.

https://doi.org/10.3390/bioengineering9020074

  1. Koller M, Mukherjee A. Polyhydroxyalkanoates–linking characteristics, applications and end-of-life options. Chem Biochem Eng Q 2020; 34 (3): 115-129.

https://doi.org/10.15255/CABEQ.2020.1819

  1. Akaraonye E, Keshavarz T, Roy I. Production of polyhydroxyalkanoates: the future green materials of choice. J Chem Technol Biotechnol 2010; 85 (6): 732-743.

https://doi.org/10.1002/jctb.2392

  1. Rodriguez-Perez S, Serrano A, Pantión AA, Alonso-Fariñas B. Challenges of scaling-up PHA production from waste streams. A review. J Environ Manage 2018; 205: 215-230.

https://doi.org/10.1016/j.jenvman.2017.09.083

  1. Novelli LDD, Sayavedra SM, Rene ER. Polyhydroxyalkanoate (PHA) production via resource recovery from industrial waste streams: A review of techniques and perspectives. Bioresource Technol 2021; 331: 124985.

https://doi.org/10.1016/j.biortech.2021.124985

  1. Kannah RY, Kumar MD, Kavitha S, Banu JR, Tyagi VK, Rajaguru P, Kumar G. Production and recovery of polyhydroxyalkanoates (PHA) from waste streams - A review. Bioresource Technol 2022; 366, 128203.

https://doi.org/10.1016/j.biortech.2022.128203

  1. Khosravi Darani, K, Vasheghani-Farahani E, Shojaosadati SA. Application of the taguchi design for production of polyβ-hydroxybutyrate) by Ralstonia eutropha. Iran J Chem & Chem Eng 2004; 23 (1): 131-136.

https://doi.org/10.30492/ijcce.2004.8171

  1. Pernicova I, Kucera D, Nebesarova J, Kalina M, Novackova I, Koller M, Obruca S. Production of polyhydroxyalkanoates on waste frying oil employing selected Halomonas Bioresource Technol 2019; 292: 122028.

https://doi.org/10.1016/j.biortech.2019.122028

  1. Sangkharak K, Khaithongkaeo P, Chuaikhunupakarn T, Choonut A, Prasertsan P. The production of polyhydroxyalkanoate from waste cooking oil and its application in biofuel production. Biomass Convers Bioref 2021; 11: 1651-1664.

https://doi.org/10.1007/s13399-020-00657-6

  1. Tripathi AD, Paul V, Agarwal A, Sharma R, Hashempour-Baltork F, Rashidi L, Khosravi Darani, K. Production of polyhydroxyalkanoates using dairy processing waste - A review. Bioresource Technol 2021; 326: 124735.

https://doi.org/10.1016/j.biortech.2021.124735

  1. Tripathi AD, Raj Joshi T, Kumar Srivastava S, Khosravi Darani, K, Khade S, Srivastava J. Effect of nutritional supplements on bio-plastics (PHB) production utilizing sugar refinery waste with potential application in food packaging. Prep Biochem Biotechnol 2019; 49 (6): 567-577.

https://doi.org/10.1080/10826068.2019.1591982

  1. Kiselev EG, Demidenko AV, Zhila NO, Shishatskaya EI, Volova TG. Sugar beet molasses as a potential C-substrate for PHA production by Cupriavidus necator. Bioengineering 2022; 9(4): 154.

https://doi.org/10.3390/bioengineering9040154

  1. Simò-Cabrera L, Garcia-Chumillas S, Benitez-Benitez SJ, Cánovas V, Monzó F, Pire C, Martinez-Espinosa RM. Production of Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) by Haloferax mediterranei Using Candy Industry Waste as Raw Materials. Bioengineering 2024; 11 (9): 870.

https://doi.org/10.1080/10826068.2019.1591982

  1. Montemurro M, Salvatori G, Alfano S, Martinelli A, Verni M, Pontonio E, Villano M, Rizzello CG. Exploitation of wasted bread as substrate for polyhydroxyalkanoates production through the use of Haloferax mediterranei and seawater. Frontiers Microbiol 2022; 13: 1000962.

https://doi.org/10.3389/fmicb.2022.1000962

  1. Brojanigo S, Alvarado-Morales M, Basaglia M, Casella S, Favaro L, Angelidaki I. Innovative co-production of polyhydroxyalkanoates and methane from broken rice. Sci Total Environ 2022; 825: 153931.

https://doi.org/10.1016/j.scitotenv.2022.153931

  1. Follonier S, Riesen R, Zinn M. Pilot-scale production of functionalized mcl-PHA from grape pomace supplemented with fatty acids. Chem Biochem Eng Q 2015; 29 (2): 113-121.

https://doi.org/10.15255/CABEQ.2014.2251

  1. Kovalcik A, Pernicova I, Obruca S, Szotkowski M, Enev V, Kalina M, Marova I. Grape winery waste as a promising feedstock for the production of polyhydroxyalkanoates and other value-added products. Food Bioprod Proc 2020; 124: 1-10.

https://doi.org/10.1016/j.fbp.2020.08.003

  1. Obruča S, Benesova P, Petrik S, Oborna J, Prikryl R, Marova I. Production of polyhydroxyalkanoates using hydrolysate of spent coffee grounds. Proc Biochem 2014; 49 (9): 1409-1414.

https://doi.org/10.1016/j.procbio.2014.05.013

  1. Obruča S, Petrik S, Benesova P, Svoboda Z, Eremka L, Marova I. Utilization of oil extracted from spent coffee grounds for sustainable production of polyhydroxyalkanoates. Appl Microbiol Biotechnol 2014; 98: 5883-5890.

https://doi.org/10.1007/s00253-014-5653-3

  1. Bomfim ASCD, Oliveira DMD, Voorwald HJC, Benini KCCDC, Dumont MJ, Rodrigue D. Valorization of spent coffee grounds as precursors for biopolymers and composite production. Polymers 2022; 14 (3): 437.

https://doi.org/10.3390/polym14030437

  1. Koller M, Obruča S. Biotechnological production of polyhydroxyalkanoates from glycerol: A review. Biocat Agricult Biotechnol 2022; 42: 102333.

https://doi.org/10.1016/j.bcab.2022.102333

  1. Koller M, Braunegg G. Biomediated production of structurally diverse poly(hydroxyalkanoates) from surplus streams of the animal processing industry. Polimery 2015: 60 (5): 298-308.

https://doi.org/10.14314/polimery.2015.298

  1. Brody AL, Bugusu B, Han JH, Sand CK, McHugh TH. Innovative food packaging solutions. J Food Sci 2008; 73 (8): 107-116.

https://doi.org/10.1111/j.1750-3841.2008.00933.x

  1. Tang XZ, Kumar P, Alavi S, Sandeep KP. Recent advances in biopolymers and biopolymer-based nanocomposites for food packaging materials. Crit Rev Food Sci Nutr 2012; 52 (5): 426-442.

https://doi.org/10.1080/10408398.2010.500508

  1. Alias AR, Wan MK, Sarbon NM. Emerging materials and technologies of multi-layer film for food packaging application: A review. Food Control 2022; 136: 108875.

https://doi.org/10.1016/j.foodcont.2022.108875

  1. Mokwena KK, Tang J. Ethylene vinyl alcohol: a review of barrier characteristics for packaging shelf stable foods. Crit Rev Food Sci Nutr 2012; 52 (7): 640-650.

https://doi.org/10.1080/10408398.2010.504903

  1. Schmid M, Dallmann K, Bugnicourt E, Cordoni D, Wild F, Lazzeri A, Noller K. Characteristics of whey-protein-coated films and laminates as novel recyclable food packaging materials with excellent barrier characteristics. Int J Polym Sci 2012; 2012 (1): 562381.

https://doi.org/10.1155/2012/562381

  1. Kovalcik A, Machovsky M, Kozakova Z, Koller M. Designing packaging materials with viscoelastic and gas barrier characteristics by optimized processing of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) with lignin. React Funct Polym. 2015; 94: 25-34.

https://doi.org/10.1016/j.reactfunctpolym.2015.07.001

  1. Koller M. Poly(hydroxyalkanoates) for food packaging: application and attempts towards implementation. Appl Food Biotechnol. 2014; 1 (1): 3-15.

https://doi.org/10.22037/afb.v1i1.7127

  1. Koller M, Marsalek L. Principles of Glycerol-Based Polyhydroxyalkanoate Production. Appl Food Biotechnol. 2015; 2 (4): 3-10.

https://doi.org/10.22037/afb.v2i4.8270

  1. Koller M, Marsalek L. Potential of Diverse Prokaryotic Organisms for Glycerol-based Polyhydroxyalkanoate Production. Applied Food Biotechnol. 2015; 2 (3), 3-15.

https://doi.org/10.22037/afb.v2i3.8271

  1. Bozorg A, Vossoughi M, Kazemi A, Alemzadeh I. Optimal medium composition to enhance poly-β-hydroxybutyrate production by Ralstonia eutropha using cane molasses as sole carbon source. Applied Food Biotechnol. 2015; 2 (3), 39-47.

https://doi.org/10.22037/afb.v2i3.8883

  1. Koller M, Hesse P, Fasl H, Stelzer F, Braunegg G. Study on the effect of levulinic acid on whey-based biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by Hydrogenophaga pseudoflava. Applied Food Biotechnol. 2017; 4 (2): 65-78.

https://doi.org/10.22037/afb.v4i2.16337

  1. Koller M, Shahzad K, Braunegg G. Waste streams of the animal-processing industry as feedstocks to produce polyhydroxyalkanoate biopolyesters. Applied Food Biotechnol. 2018; 5 (4): 193-203.

https://doi.org/10.22037/afb.v5i4.18557

  1. Koller M. Linking food industry to “green plastics”–polyhydroxyalkanoate (PHA) biopolyesters from agro-industrial by-products for securing food safety. Applied Food Biotechnol. 2019; 6 (1), 1-6.

https://doi.org/10.22037/afb.v6i1.17979

  1. Brigham CJ, Riedel SL. he potential of polyhydroxyalkanoate production from food wastes. Applied Food Biotechnol. 2019; 6 (1): 7-18.

https://doi.org/10.22037/afb.v6i1.22542

  1. Chee JY, Lakshmanan M, Jeepery IF, Hairudin NHM, Sudesh K. The potential application of Cupriavidus necator as polyhydroxyalkanoates producer and single cell protein: A review on scientific, cultural and religious perspectives. Applied Food Biotechnol. 2019; 6 (1): 19-34.

https://doi.org/10.22037/afb.v6i1.22234

  1. Cinelli P, Mallegni N, Gigante V, Montanari A, Seggiani M, Coltelli MB., Bronco S, Lazzeri, A. Biocomposites based on polyhydroxyalkanoates and natural fibres from renewable byproducts. Applied Food Biotechnol. 2019; 6 (1): 35-43.

https://doi.org/10.22037/afb.v6i1.22039

  1. Favaro L, Basaglia M, Rodriguez JEG, Morelli A, Ibraheem O, Pizzocchero V, Casella S. Bacterial production of PHAs from lipid-rich by-products. Applied Food Biotechnol. 2019; 6 (1): 45-52.

https://doi.org/10.22037/afb.v6i1.22246

  1. Kumar P, Kim B. Paracoccus strain LL1 as a single cell factory for the conversion of waste cooking oil to polyhydroxyalkanoates and carotenoids. Appl Food Biotechnol. 2019; 6 (1): 53–60.

https://doi.org/10.22037/afb.v6i1.21628

  1. Bustamante D, Tortajada M, Ramon D, Rojas A. Camelina oil as a promising substrate for mcl-PHA production in Pseudomonas cultures. Appl Food Biotechnol. 2019; 6 (1): 61-70.

https://doi.org/10.22037/afb.v6i1.21635

  1. Rebocho AT, Pereira JR, Freitas F, Neves LA, Alves VD, Sevrin C, Grandfils C, Reis MA. Production of medium-chain length polyhydroxyalkanoates by Pseudomonas citronellolis grown in apple pulp waste. Appl Food Biotechnol. 2019; 6 (1): 71-82.

https://doi.org/10.22037/afb.v6i1.21793

  1. Pernicova I, Enev V, Marova I, Obruca S. Interconnection of waste chicken feather biodegradation and keratinase and mcl-PHA production employing Pseudomonas putida Appl Food Biotechnol. 2019; 6 (1): 83-90.

https://doi.org/10.22037/afb.v6i1.21429

  1. Amini M, Sobhani S, Younesi H, Abyar H, Salamatinia B, Mohammadi M. Evaluating the feasibility of poly (3-hydroxybutyrate-co-3-hydroxyvalerate) co-biopolymer production from rice wastewater by Azohydromonas lata. Appl Food Biotechnol. 2019; 7 (2): 73-83.

https://doi.org/10.22037/afb.v7i2.26642

  1. Umesh M, Santhosh AS. A strategic review on use of Polyhydroxyalkanoates as an Immunostimulant in aquaculture. Appl Food Biotechnol. 2021; 8 (1): 1–18.

https://doi.org/10.22037/afb.v8i1.31255

 

 

Original Article


 

Abstract

 

Background and Objective: Use of natural ingredients is a safe efficient approach to overcome various diseases. Encapsulated ginger extract has shown improved physicochemical characterizations, compared with that, the ginger extract has. In this study, a natural system integrated with ginger bioactive compounds (6-gingerol) and green microalgae of Chlorella vulgaris was reported to increase bioactive compounds medicinal effectiveness and introduce a novel food supplement.

Material and Methods: First, nanoparticles of microalgae were produced using ball-milling technique. Ethanolic ginger extract, loaded on microalga nanoparticles, was investigated at various pH values (2-7.4) to effectively release the active agents. Various analytical techniques (e.g., Fourier transform infrared, thermogravimetric analyses) were used to characterize the nanocomposite and investigate its anticancer and antimicrobial effects.

Results and Conclusion: Dynamic light scattering showed a medium size of 20.9 nm for the microalga nanoparticles. The release assay of ginger polyphenols showed a releasing process controlled by the pH. Fourier transform infrared, thermogravimetric analysis and differential thermal analysis revealed adsorption of ginger extract on nano Chlorella vulgaris surface. Moreover, 2,2-diphenyl-picrylhydrazyl bioassay results on the nanocomposite (GE@nano C.v) verified its significant antioxidant, antibacterial and anticancer activities. The nanocomposite has the minimum inhibitory effect on human breast adenocarcinoma cells and bacterial growth at 1 and 6.25 mg ml-1 concentrations, respectively. In brief, adsorption of ginger extract on the microalga nanoparticle surfaces enhanced physical and chemical characteristics of the ginger extract, compared to its free form. Bioactive compounds in Chlorella vulgaris and ginger extract strengthen their reported activities. Furthermore, microalgal nanoparticles could act as a safe carrier for the controlled release of 6-gingerol in addition to their nutraceutical characteristics. 

Conflict of interest: The authors declare no conflict of interest.

 

Article Information

 

Article history:

- Received

19 Nov 2023

- Revised

17 Jan 2024

- Accepted

17 Feb 2024

 

Keywords:

▪ Antitumor

▪ Food supplement

▪ Ginger

▪ Microalgae

▪ Natural nanomedicine

 

*Corresponding author:

 

Mahdi Rahaie *

Department of Life Science Engineering, Faculty of New Sciences and Technologies, University of Tehran, Tehran 14399-57131, Iran.

 

Tel: +98-21-86093408

 

E-mail:

mrahaie@ut.ac.ir  

 

How to cite this article

Rajabi M, Rahaie M, Sabahi H. Design and Synthesis of a New Anticancer and Antimicrobial Nanocomposite by Microalgae Based on an Up-down Approach. Appl Food Biotechnol. 2024; 11 (1): e15. http://dx.doi.org/10.22037/afb.v11i1.43923

 

  1. Introduction

 

By decreasing consumption of essential nutrition, various chronic diseases emerge. This dilemma needs a reliable effective solution to prevent future malnutrition illnesses. Nowadays, plant and algal-derived supplies as functional foods are attracting public attentions due to healthful bioactive components and their therapeutic effects [1,2]. One of the wide subgroups of algae includes microalgae. Algal biomass includes diverse health-beneficial bioactive compounds such as fibers, carotenoids, polysaccharides, polyphenols and peptides that are resulted from various metabolic pathways and effective on cardiovascular diseases (CVDs), types of cancers, atherosclerosis, neurodegenerative diseases, obesity, gut health, bone health, inflammation, type II diabetes and antioxidant and antiviral activities [3,4]. In developing seaweeds and microalgal foods, aspects such as consumer awareness and demands, bioactive compound bioavailability and stability, cost-effectiveness and life durability needs further attentions. Moreover, only a few species of microalgae are approved for the human consumption as foods due to strict food safety regulations. These include Arthrospira platensis (spirulina), Chlorella spp., Aphanizomenon flosaquae, Schizochytrium spp., Scenedesmus spp., Dunaliella salina, Tetraselmis chuii, Haematococcus pluvialis and Porphyridium purpureum as resources of human nutrition within the microalgal species [5,6]. It has been reported that bioactive agents are critical for better health conditions. Therefore, plant phytochemicals have been selected as they include generally favorable characteristics such as less toxicity and well bearing by normal body cells. Frequently assessed bioactive compounds in plant extracts include curcumin, gingerol, β-carotene, quercetin and linamarin, which are developed as anticancer drugs. These compounds are rich in active agents such as phenols, alkaloids, flavonoids and tannins, which include high anti-inflammatory, antioxidant, antimicrobial, antica-ncer and antiaging activities [7,8].

One of the active agents of the ginger (Zingiber officinale) rhizome is found in the polyphenol group of 6-gingerol, which is popular for the protection of several cancers. The 6-gingerol mechanism includes interfering with a number of cell signaling pathways that affect balances between the cell proliferation and apoptosis [9]. These lead to effective approaches majorly for liver carcinoma and breast cancer. In addition, antiviral, antimicrobial, antihyperglycemic, antilipidemic, cardioprotective and immunomodulatory activities have been shown. However, 6-gingerol disadvantages such as pH and oxygen sensitivities, temperature lability, light instability and poor aqueous solubility limit its potential administrations. Thus, novel approaches for efficient delivery of 6-gingerol in a targeted controlled manner is critically important [10]. Drug delivery paths have been improved with developing of nanotechnology science. Appropriate drug-delivery nanosystems are used to enhance drug stability, specificity and durability in human blood circulatory system. Various drug vehicles have been introduced to improve drug efficiency and therapeutic effects. Some nanotechnology systems used for targeted drug delivery include dendrimers, micelles, carbon nanotubes, nanoparticles and liposomes, which are extensively used in various industries such as cosmetic, food, medicine, health, energy, electronics and environment industries [11,12]. Additionally, nanote-chnology has provided a path; in which, well-qualified and practical forms of foods with nutrient bioavailability can be produced. Moreover, most of the recent studies is dedicated to crop and food processing developments through nanotechnology [13].

One of the nanotechnology approaches in food technology includes a top-down approach that uses nanostructures from bulk materials by size decreasing via milling, nanolith-ography or accurate-engineering techniques. In contrast to nanostructures with a large surface area-to-volume ratio, this nano-approach induces a higher activity and enhances performance. Factors such as non-specificity, low stability and aggregation can delay these nanotechnologies' uses because of decreased functions. To extend stability of nanosize structures, associating a host material (as a matrix or support) can be an alternative way to overcome the former issues [13-15]. Ginger is an old additive and traditional medicine; previous studies on using ginger extract for therapeutic approaches have been less effective, compared with the loaded ones in a carrier due to less stability and low solubility. Therapeutic characteristics of this natural medicine are limited as previously stated. Moreover, Chlorella (C.) vulgaris is approved by the Food and Drug Administration (FDA) with nutritional and medicinal characteristics and potential of uses as a natural carrier. To enhance physiochemical characteristics of ginger extract, containing health-promoting bioactive compounds, as well as natural ingredient demands in food nutraceutical and medical industries, a nanocomposite was designed that was a novel approach to overcome disadvantages of using ginger extract alone. In this study, a nano-microalga was synthetized using up-down path as a carrier for ginger extract. Moreover, composite was assessed using several bioassays.

  1. Materials and Methods

2.1. Materials

Ginger rhizome was purchased from a local market in Tehran, Iran. Moreover, 2,2-diphenyl-1-picrylhydrazyl (DPPH), Folin-Ciocalteu reagent, Gallic acid and sodium carbonate were purchased from Sigma-Aldrich, USA. Methanol (purity>99%) and ethanol (purity≥99.7%) were provided by Merck, Germany. Fresh C. vulgaris microalgae was provided by the Faculty of New Sciences and Technologies, University of Tehran, and cultured before use. All the chemicals included analytical grades and deionized water was used to prepare solutions.

2.2. Microalgae culture

Briefly, BG-11 liquid media were used to propagate C. vulgaris. Microorganism was inoculated at 10% using 500-ml flasks of 200 ml of BG-11. Culture flasks were incubated using rotary incubator at 25 ℃ ±2 and 100 rpm. Cells were harvested by centrifugation (Awel, model MF 20-R, France) at 8000 rpm for 10 min at 4 ℃. These were freeze-dried (Operon, model FDB 5503, South Korea) [16].

2.3. Ginger extraction

Ginger rhizomes were dried at room temperature (RT) and grounded using blender and then the fine powder was stored at -20 ℃ for further use. Extraction method (maceration technique) reported by Ali, et al. was used with modifications [17]. Generally, 5 g of the ginger powder were transferred into a 50-ml tube and extracted with 25 ml of 70% ethanol at 26 ℃ for 72 h using shaker-incubator. The hydroalcoholic extract was filtered through Whatman filter papers (Whatman, UK) to separate from the solid phase. Concentrated extract, achieved using rotary evaporator and freeze-drier, was stored at 4 °C until use.

 

2.4. Characterization of the ginger extract

2.4.1. Total phenol content of the ginger extract

To investigate total phenolic content of the extract, Folin–Ciocalteu method was used [18]. Gallic acid calibration curve was plotted using mixture of ethanolic solution of Gallic acid (1 ml) and Folin–Ciocalteu reagent (200 µl, 10× diluted) and sodium carbonate (160 µl, 0.7 M). Absorbance ratio of the solution was read using UV-Vis spectrophotometer (Thermo, WPA, Germany) at 760 nm. To assess the total phenolic content, ginger extract was mixed with the highlighted reagent and the absorbance ratio was measured with three replicates. Equation 1 was used for the calculation of total phenolic compounds as follows.

T = C ^ V/M                                                                                          Eq. 1

Where, T was the total phenolic content [mg g-1 sample extract in Gallic acid equivalents; C was the concentration of Gallic acid established from the calibration curve (mg ml-1 )]; V was volume of the extract (ml); and M was mass of the sample extract (g) [19]. Results were expressed as µg of ginger extract ml-1 of supernatant based on the calibration equation. Calibration equation of the ginger polyphenols (6-gingerol) was achieved via UV [absorbance value = 0.0507 (ginger polyphenols concentration in mg ml-1) - 0.0636 (R2 = 0.991)].

2.4.2. High-performance liquid chromatography analysis

Waters liquid chromatography apparatus, including a separation module (Waters 2695, USA) and a photodiode array detector (PDA) (Waters 996, USA) was used for high-performance liquid chromatography (HPLC) analysis. Data acquisition and integration were carried out using Millennium 32 software. Injection was carried out using auto-sampler injector. Chromatographic assay was carried out on a 15 cm × 4.6 mm with pre-column, Eurospher 100-5 C18 analytical column provided by Waters (sunfire) reversed-phase matrix (5 μm) (Waters, USA) and eluting was carried out in a gradient system with ACN as the organic phase (Solvent A) and distilled water (DW) (Solvent B) with a flow-rate of 1 ml min-1. Injection volume was 20 µl and temperature was set at 25 °C (run time, 40 min and columns size, 2.1 mm) [20].

2.5. Size decreases in nanoscale, dynamic light scattering and zeta potential

Nano-microalgae powder with nanometer dimensions was produced using ball-milling technique (600 rpm, 6 h). Ball-milling process was carried out at 27 ℃, to avoid excessive heating. Temperature was controlled using air-cooling system. After the process, samples were transferred into a closed container to prevent moisture. The most common technology for assessing particle sizes based on particle-light interactions is dynamic light scattering (DLS) technique. Assessment of the nano C.v size was carried out using particle size analyzer (Horiba, SZ100 model, Japan). A critically physical parameter to identify surface charges of a particle (microalgae, GE, nano C.v and GE@nano C.v) in suspensions, which could anticipate interactions, is zeta potential analysis (ζ). Technically, ions around the particles dispersed in the fluid regulate charges of the particle surface layer. In this study, zeta potential was assessed using Smoluchowski formula (Eq. 2) as follows.

Ζ = µ                                                                                                     Eq. 2

Where, η was viscosity of the media, ε was the permittivity and μ was the electrophoretic mobility [21]. In this study, zeta potential of the samples (ginger extract, micro C. vulgaris cell, nano C. vulgaris, GE@micro C.v and GE@nano C.v) homogenized in deionized water via ultrasound technique was assessed (Malvern, model ZEN 3600, UK).

2.6. Adsorption experiment

Ethanolic ginger extract was adsorbed onto C. vulgaris surface as a function of stirring time and ginger extract dosage. A suspension of 5 mg ml-1 nano C.v and 0.5 mg ml-1 ginger extract was stirred for 1, 2, 4, 6, 8, 10 and 12 h and then centrifuged (5000 rpm, 15 min). The harvested GE@ nano C.v (ginger extract on nanoparticles of C. vulgaris) was freeze-dried. As the adsorption yield curve (%) reached a plateau pattern after 1 h, this time was selected as the stirred time. Various quantities of GE (0.1, 0.2, 0.4, 0.6, 0.8 and 1 mg ml-1) were suspended in flasks containing 5 mg ml-1 nano C.v (dissolved in 70% ethanol), stirred for 1 h and then centrifuged (5000 rpm, 15 min). The harvested GE@nano C.v was freeze-dried. Polyphenol assessment (especially 6-Gingerol) of ginger extract adsorbed onto nano C.v was carried out as follows: 1 ml of the solution was collected and centrifuged (5000 rpm, 15 min). Supernatant was separated from the sediment and re-centrifuged (12,000 rpm, 10 min). Concentration of the GE was calculated at 760 nm, using UV-visible spectroscopy (Thermo, WPA, Germany) [16]. Encapsulation efficiency (EE%) and encapsulation yield (EY%) were calculated using Eqs. 3 and 4:

Encapsulation efficiency (%) =  × 100                                                Eq. 3

Encapsulation yield (%) =  × 100                                                Eq. 4

2.7. Verification of adsorption

To verify adsorption of ginger extract on nano Alg surface, Fourier transform-infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermogravimetric analysis (DTA) were carried out.

2.7.1. Thermogravimetric analysis

The TGA was carried out at a heating rate of 10 ℃ min-1 from RT to 600 ℃ with the inert nitrogen gas of 50 ml min-1 using thermal gravimetric analyzer (TGA/DSC/1, Mettler Toledo, Singapore).

2.7.2. Differential thermogravimetric analysis

The DTA analysis of the GE, nano C.v and nano Alg/GE was carried out to assess physical state of the extract in this carrier and possibility of the interactions between the GE and the microalga.

2.7.3. Fourier transform-infrared spectroscopy

Chemical characteristics of the material were investigated using FTIR spectroscopy (Perkin-Elmer Frontier, USA) using KBr disks in the range of 400–4000 min-1.

2.7.4. Antioxidant assay (total antioxidant capacity)

Photochemical stabilities of the nanocomposite (GE@ nano C.v) and ginger extract were assessed via a procedure described by Paramera et al. [22] with minor modifications. Free GE (200 mg) and a quantity of each nanocomposite (containing 200 mg of ginger polyphenols) were exposed to sunlight for a month using enclosed glass Petri dishes. Time of the light exposure included 12 h day-1 with a total of 720 h. The average daily temperature within the month was 25 ℃. After exposure for 7, 14 and 30 d, samples were collected and bioactivities of their 6-gingerol were assessed as follows: antioxidant activity of dispersed GE and nanocomposite (GE@nano C.v) were assessed using DPPH free radical scavenging method [23]. Inhibition of DPPH radicals by the samples was calculated using Eq. 5 as follows.

DPPH inhibition (%) =  × 100              Eq. 5

Where, A control was the absorbance spectrum without GE and A sample was the absorbance of ginger polyphenol nanocomposite.

2.8. In vitro assays

2.8.1. Antibacterial assay

Staphylococcus aureus ATCC 33591, Pseudomonas aeruginosa ATCC 9027, Salmonella enterica ATCC 9270 and Escherichia coli ATCC 10536 were selected for the antibacterial susceptibility assay. Minimal inhibitory concentrations (MICs) of the ginger extract and nanocomposite were assessed using microtube dilution assay as described by Acharya and European Committee for the highlighted bacterial strains. Ethanolic extract concentrations of 2.5, 1.25 and 0.625 mg ml-1 and nanocomposite concentrations of 1-4 mg ml-1 (consisting of ginger extract) were prepared using serial dilution in LB broth and 0.5 McFarland standard (108 CFU ml−1) of the bacterial suspensions was added to each tube. All tubes were incubated at 30 °C for 14 h at 100 rpm. Absorption of each sample was measured at 600 nm using UV-vis spectroscopy (Thermo, WPA, Germany). The lowest extract concentration that inhibited bacterial growth was recorded as MIC (in three independent experiments) [24]. Inhibition of the bacterial growth was calculated using Eq. 6 as follows.

Antibacterial activity (%) =  × 100                                                                                                                         Eq. 6

Where, Apositivecontrol was the absorbance spectrum without samples (ginger extract and nanocomposite) and Asample was the absorbance of bacteria with certain concentrations of ginger extract and nanocomposite. Culture media was used as blank.

2.8.2. Cytotoxicity assay

In this study, human breast adenocarcinoma MCF-7 cell line was cultured using T-25 cell culture flasks containing Hi-Gluta XL Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), streptomycin (100 µg ml-1) and penicillin (100 U ml-1). Cells were propagated using cell culture incubator supplied with 5% CO2 at 37 ℃. cells were seeded overnight using 96-well cell culture plates and RPMI media suspension of three treatments (ginger extract, nano C.v and GE@nano C.v) was added to the wells at a confluence of 70% to avoid possible interferes of DMEM media with the samples (200 µl total volume). The control wells included no agents. Experiments were carried out with three replicates. Effects of each treatment on cancer cell growth were assessed after 24, 48 and 72 h, separately. After treatment of cells with various concentrations of the samples (0.5, 0.75 and 1 µg ml-1) in each well for 24, 48 and 72 h, cells were rinsed with 1× PBS buffer and incubated with 100 µl of 0.5 mg ml-1 MTT at 37 ℃. After 4 h of incubation, 100 µl of DMSO were added to dissolve the dark-blue crystals of formazan (MTT metabolites) and incubated for 30 min at 37 ℃. Then, absorbance of the reduced MTT was measured at 560 nm using plate reader device (Convergys ELR 96×, Germany) [25].

2.9. Statistical analysis

Data represent mean ±SD (standard deviations) of three replicates. The mean comparisons were carried out using one-way variance analysis (ANOVA). Antioxidant activity data of nanocomposite and ginger extract were analyzed in a completely randomized block design with three replicates and three treatments (exposure to sunlight for 0, 14, 30 and 60 d). Duncan multiple range test (p<0.05) was used to assess significance of the difference within the treatment means. Data for each analysis were represented as the mean ±SE (standard error) of the mean.

  1. Results and Discussion

3.1          High-performance liquid chromatography analysis

The HPLC analysis was carried out to quantify 6-gingerol as a bioactive compound (polyphenol) with therapeutic characteristics as well as antioxidant activities. Chromatograms in Fig. 1b show spectra associated to ginger extract as well as the standard spectra of 6-gingerol (Fig. 1a). Peaks linked to 6-gingerol at 14.38 min were clearly present in the two spectra, showing 6-gingerol in the ginger extract. Using data, standard curve of 6-gingerol was first plotted and then quantity of 6-gingerol in the ginger extract was calculated as 96 mg g-1 DW (dry weight) extract (Fig. 1 c). This value was higher than that by Yamprasert et al. (2020), where concentration of 6-gingerol in the extract was calculated as 71.13 mg g-1 using soaking method [26]. Compared to the method by Simonati et al. (2009) that calculated 170 mg g-1, the former value was lesser, which could be due to the use of supercritical fluid[1] extraction technique and high pressure for extraction in that study [27].

3.2. Release assay

Release assessment of 6-gingerol in the ginger extract was carried out based on the absorbance at 760 nm in the simulated environment of body conditions with pH 7.4 using Folin-Ciocalteu reagent at various times. Since extract was loaded on nanoparticles of the microalgae, further releases were expected at the beginning. At t = 1 h in the acidic conditions similar to the stomach with pH 2, the release rate was 16% and at pH 7.4, the rate was 14%. Up to 72 h, the release rate was constant with mild changes and reached 18% (Fig. 2). Complete release of the ginger extract was not observed at no pH conditions. However, release of the extract in acidic conditions of the stomach was higher, which was due to the effects of acidic pH on interactions between the algal nanoparticles and the extract as well as the surface load. According to Zarei et al., release rates of gingerol loaded in pegylated and non-pegylated nanoliposome respectively were 3.1 and 4.8% within 48 h [28]. Release rate in report of Jafari et al. was nearly 39% within 2 h and 59% within 4 h [16]. In another study by Shateri et al., release comparison of two synthetic systems (BCE-Spirulina and BCE-nanosized Spirulina) was investigated in physiological (pH 7.4) and acidic (pH 1.2) conditions within 96 h. Release rates of the extract were respectively calculated as 50 and 40% within the first 12 h. Based on the results, release of extract from the nanocomposite was faster and higher at the two pH conditions because of loading further extracts on the Spirulina surface, compared with the microalgal whole cell. The plateau curve was seen after 48 h, which reached 50% in acidic pH [29].

3.3. Dynamic light scattering and zeta potential assessments

To assess sizes of the ground C. vulgaris nanoparticles, an appropriate quantity of the microalgal nanoparticles was first dissolved in DW and sizes of the particles were assessed after sonication for 15 min. Sizes of Chlorella nanoparticles included 20.9 nm. Sharp peak and high height of the peak ndicated the high number of the particles (90%) in this size range (Fig. 3). Furthermore, C. vulgaris included three growth phases of log, stationary and lag phases. In the early log phase, a fragile unilamellar layer with 2-nm thickness could be demonstrated. Through maturation (log phase), cell wall thickness gradually increased to 17-20 nm, forming a microfibrillar layer of glucosamine. Due to the variation of cell wall rigidity of C. vulgaris within the growth phase, appropriate digestion and absorption of the valuable nutritional substances were limited [30]. Therefore, nano-sized microalgae were used not only to overcome problems of the ginger extract adsorption onto the Chlorella surface, but also to enhance drug loading efficiency of the synthetic nanocomposite.

Naturally, surface groups, extracellular products and cell structures affect electric characteristics of cells. In physiological pH, zeta potentials of the ginger extract (GE), C. vulgaris (microalgae), nanoparticles of C. vulgaris (nano C.v), microcomposite (GE@micro C.v) and nanocomposite (GE@nano C.v) included -22.8, -16.8, -27.2, -4.3 and -9.3 mV, respectively (Fig. 4). Based on the results, the lowest quantity of the extract could be loaded on the particles of C. vulgaris, this occurred due to the negative surface charge and repulsion in loading process. The whole cell of C. vulgaris included a negative surface charge of -16.8 mV; similar to that of Hao, et al., which linked to cell wall compositions of majorly cellulose, hydroxyl(-OH), carboxyl(-COOH) and aldehyde(-CHO) groups with negative charges [31]. Surface charge of the nanocomposite was -9.35 mV, becoming further positive and closer to the charge of the extract that indicating better adsorptions of the ginger extract on the microalgal nanoparticles. Zeta potential of the synthesized nanocomposite could be addressed as the reason for the low adsorption of ginger on the microalgal surfaces. Results showed that by shrinking the size of C. vulgaris particles from micrometers to 20 nm (less than 100 nm) with effects on physical characteristics, its surface charge became further negative and closer to -30 mV; thus, its stability increased due to the increases in the ratio of surface to volume [32]. Moreover, surface charge of the ginger extract was -22.8 mV, similar to that reported by Min Ho et al. This was because of the presence of carbohydrates and numerous anion sites, lipids and polyphenols due to possible groups in the extract [33].

3.4. Fourier transform-infrared spectroscopy analysis

Figure 5 shows FTIR graphs of ginger extract, microalgae and nanocomposite (GE@nano C.v), to indicate chemical groups in each treatment individually and characterize their interactions in synthetized nanocomposite.

 

 

A

 

 

 

B

 

 

 

C

 

 

 

Figure 1. High-performance liquid chromatography peaks corresponding to 6-gingerol standard (260 ppm) (a), ginger extract (b) and 6-gingerol content of the ginger extract (c).

 

 

Figure 2. Release rate curves of the ginger extract from nanocomposite at two acidic (red line) and neutral (black line) pH values.

Figure 3. The size measurement of Chlorella vulgaris particles after milling by DLS technique. Most of the particles' sizes are in the average of 20.9 nm.

 

Figure 4. Surface charges (zeta potentials) of the four samples. GE (orange), Chlorella vulgaris whole cell (green), Chlorella vulgaris nanoparticles (green pattern), microcomposite (blue) and nanocomposite (light blue pattern).

 

 

3.4.1. The ginger extract

 

The strong band located in the area of 3527.24 was linked to alcohol groups (O-H) and the presence of intramolecular and intermolecular hydrogen bonds; which could be associated to carbohydrates and polyphenols in the extract. The peak in the area of 2916.69 showed asymmetric stretching vibration of the C-H group and possibly the carboxyl group [34]. In addition, FTIR spectrum of the ginger included a relatively strong peak at 1606.5 , which was in the range of 1600–1609 and linked to the ring of polyphenols. The absorption spectrum in 1515.8 belonged to the nitro-aromatic groups of ginger extract. The broadening of the peak in the area of 1500–1800 indicated double and amide bonds. Moreover, C=O stretching bonds and N-H bending bonds when showing a broad peak in the range of 1516-1863.86 centered on the 1638  area. Presence of a 1268.13 was associated to the vibrations of alkyl ether and ester groups, demonstrating presence of triglycerides in the extract [35]. Furthermore, peak of 1040.10  included bending vibrations of the C-C bond of cellulose extract [33]. Absorption bands in the area of 924.45 were linked to carbon-carbon double bonds [36].

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 5. Fourier transform-infrared spectroscopy spectra of the ginger extract (GE, orange), nanocomposite (GE@nano C.v, blue) and nano Chlorella vulgaris (nano C.v, green).

 

 

3.4.2. Microalgae

Spectrum of C. vulgaris microalgae showed several peaks in various areas. The band of 3316.01  corresponded to the O-H stretching group, revealing presence of a strong alcohol group. Area of 1659.46  showed a strong band, sign of the presence of the first type of amide group within the proteins. Band of 2927.12 demonstrated presence of lipids in microalgae [37]. Band in the area of 2855.44 showed the bending CH2 group linked to carbohydrates and lipids. Band in the area of 1738.96 cm-1 highlighted ester bond of the carbonyl group. Peak in the area of 1547.97 belonged to the proteins and C=O stretching group. Presence of peaks in the areas of 1406.05 and 1242.77 was linked to the carbon-carbon bending group and the carboxylic acid group of microalgae, respectively. Peak of 1072–1099  was associated to -O-C group of carbohydrates, nucleic acids and other phosphate-containing compounds. Moreover, peak of 980–1072 belonged to the group (C-O-C) of polysaccharides [16,38].

3.4.3 Nanocomposite

Nanocomposite spectrum was located between the FTIR spectra of extract and microalga with further similarity to the extract, which could be attributed to loading of the extract on the microalgae. In FTIR spectra of the nanocomposite, bands were removed, replaced or decreased in depth. Band in the range of 3500–3300  of the spectra of the extract and microalga nanoparticles shifted to the left (3667.23 ) in the spectra of the nanocomposite, revealing connections of the extract with microalga. Lack of 3527 peak of the extract could be due to the interactions of O-H group of phenol with microalga. In contrast, 2927 peak of Chlorella became wider in the present nanocomposite, which was possibly due to the interactions of microalga with the extract. The microalga peak shifted from 1738 to 1728.65 and the extract from 1515 to 1534.94 in the nanocomposite could be due to the interactions of microalgal proteins with the extract through C=O and N-H groups, respectively. Peak in 1047  area of the extract could be seen in the spectra of the nanocomposite. Peaks between 924 and 564 cm-1 in the extract and peaks between 1242 and 582 cm-1 of Chlorella in the nanocomposite were removed, demonstrating interactions between the extract and microalga and the formation of C-C and C-O single bonds.

3.5. Thermogravimetric analysis assay

Investigating thermal stability (Fig. 6), graph of microalga showed its three-stage mass losses due to the pyrolysis process (25-600 ℃), which ultimately led to 70% decreases in the mass of microalga. Biomass's type and composition could change the TGA curve. In the first stage, mass losses occurred due to dehydration [16]. Nearly 4.65% of the microalga mass decreased as water evaporation up to 117 °C occurred (moisture loss). Small changes in the slope of the graph at 117-201 °C could be due to the beginning of the decomposition of compounds such as hemicellulose and carbohydrates. By increasing the temperature to values higher than 117 ℃, the second stage of biomass degradation began with a sharp slope (major zone).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 6. Thermogravimetric analysis of the three samples: nano C.v (green), nanocomposite (blue) and ginger extract (orange).

 

 

Hence in the temperature range of 201–379 °C, nano C.v biomass quickly decreased by 46%, which could be caused by decomposition of the components. Volatile compounds such as organic materials, proteins, lipids, carbohydrates and cellulose and at higher temperatures (up to 379 °C), lignin, carbon materials and minerals (nearly 12% wt), were decomposed slowly [16,39,40]. With a low slope of the graph (third stage of 400–600 ℃), all volatile components of nano C.v were removed and non-volatile components were destroyed left as amorphous carbon forms [39]. In ginger extract graph, the mass curve decreased gradually. At 100 ℃, the first peak corresponded to the water loss (6.46%) [41]. The second weight loss occurred at 142.8–172.4 ℃, which represented decomposition of several aromatic compounds [42]. In the third stage (172.4-241.6 ℃), organic compound degradation occurred in decomposition of organic materials [43]. The last and the major step of mass loss occurred at 241.6-600 ℃ (36.6%) due to organic compound oxidation, lignin and cellulose degradation and complete decomposition [43]. The second and the third stages of GE degradation occurred at 142–241 ºC, while this range for GE@nano C.v was 210-300 ºC, meaning that synthesize of nanocomposite (GE@nano C.v) led to thermal stability of the ginger extract up to 300 ℃. In contrast, onset of the destruction temperature of microalgae was at 200 ℃. In nanocomposite graph, degradation temperature began at 150 ℃, showing that when the extract was loaded on C. vulgaris, degradation began earlier. As previously reported by Shetta et al. [44], green tea extract on the surface of chitosan nanoparticles was destroyed faster. This higher thermal stability of GE after adsorption on nano C.v is similar to that of Jafari et al. study, which demonstrated that thermal stability of curcumin was improved after its encapsulation into C. vulgaris [16]. Therefore, thermal degradation of organic compounds (the major step) in the nanocomposite occurred at higher temperatures, compared to those in ginger extract and nanomicroalga (two degradation steps). This could address improved intramolecular interactions between the ginger extract chemical groups and nanomicroalga that suggested a natural nanocomposite with enhanced thermal characteristics.

To calculate the quantity of ginger extract adsorbed on C. vulgaris surface, Eq. 7 by Shateri et al. [29] was used as follows.

Calculated mass residue =    Eq. 7

Where, x was the load quantity (%). Based on the formula, quantity of the extract loaded on the microalga was 31.64%. Table 2 shows weight decompositions (%) of the three samples.

3.6. Differential thermal analysis

The DTA curve shows thermal difference analysis. The technique calculated differences between the sample temperature and the reference temperature. The DTA graph shows a better temperature difference, compared with the TGA curves [49]. As shown in Fig. 7, DTA curves showed degradation peaks of nano CV, GE and GE@nano CV composite. In nano C.v, a calorific peak was seen at 100 °C, revealing dehydration and water loss. A strong second peak and a weak peak at 200 °C specify thermal decomposition of various Chlorella compounds and beginning of their degradation.

 

 

 

Table 1. Comparison of the current study with similar studies using various drug carriers and their effects.

Carrier

Cargo

Loading (%)

Positive effects

Reference

Spirulina platensis

Doxorubicin

85

+ Anticancer efficacy on lung metastasis

Biodegradable

Improved fluorescence imaging

[45]

Spirulina platensis

Black cumin

81.94

+ Antibacterial activities

+ Antioxidant activities

+ Anticancer activities

+ Thermal stability

[29]

Chlorella vulgaris

Curcumin

55

+ Thermal stability

+ Photostability

[16]

Chlorella pyrenoidosa cells

Lycopene

96.31

+ Stability

+ Antioxidant activity

[46]

Polymeric micelles (TPGS/PEG-PCL)

6- Gingerol

79.68

+ Solubility of 6-gingerol

+ Oral bioavailability

+ Improved brain distribution

[47]

Nanostructured lipid carriers

6- Gingerol

76.71

Higher drug concentrations in serum

+ Solubility of 6-gingerol

+ Oral bioavailability

[48]

Chlorella vulgaris

Ginger extract

31.64

+ Antibacterial effect

+ Antioxidant activities

+ Anticancer activities

+ Thermal stability

This work

 

Table 2. Thermogravimetric analysis assay with weight decreases as the temperature changes for the three samples (nanocomposite, nano C.v and GE).

Samples

Temperature range (℃)

Weight loss (%)

Nanocomposite

25.00-157.88

5.77

 

157.88-600.70

63.43

Nano Chlorella vulgaris

24.50-117.31

5.46

 

117.31-201.39

4.90

 

201.39-379.55

46.65

 

379.55-600.77

12.94

Ginger extract

24.60-142.8

6.46

 

142.8-172.4

6.39

 

172.4-241.62

18.26

 

241.62-600

36.69

 

 

 The fourth strong heating peak was observed at 300 °C, which included almost destruction of the microalga [39]. In DTA curve of GE, three strong peaks were seen in the temperature range of 100-200 °C (respectively from left to right: endothermic, endothermic and exothermic); which belonged to dehydration, destruction and decomposition of the major compounds in the ginger extract. Other exothermic and endothermic peaks were seen in the range of 200-300 °C. Residual and volatile compounds and carbohydrate depolymerization of the extract were almost completely decomposed, based on the studies by Kuk et al. [50].

Diagrams of DTA of GE@nano C.v were similar to diagrams of nano C.v, showing low loads of the extract. The two peaks of nano C.v degradation at 200 and 300 °C decreased to one peak at 250 °C. This major change in the decomposition peak of nano C.v showed that GE absorption on microalga nanoparticles was so strong that caused major changes in the rate and point of its decomposition. Diagram of the nanocomposite is plotted to the left, compared to that of the extract. Interactions between the extract and the microalga decreased thermal resistance in the range of 200-300 °C, which could be caused by weak interactions. In contrast, heat flow of the microalgae and its mild changes could be due to the low superficial loading of the extract on surface of the microalga as well as weak connections caused by it. It could be interpreted at a heating rate of 10 min/℃ in the first stage of the heating process with a peak at 55 °C with a molecular weight (MW) of 0.09 and a second peak of heat removal at 114 °C with an MW of 0.05 possibly due to the water loss. Thermal decomposition in the second stage was exothermic with two weak peaks at 236 °C and a strong peak at 297 °C with MWs of 0.2 and 0.35. This is the maximum heat loss due to protein decomposition at the top of the peak and carbohydrates, where bonds included O-O, N-O, C-N, C-C, C-O, N-H, C-H, N=N, H=H, O-H, O=O, C=C, C=N and C=O.

 

 

Figure 7. Differential thermogravimetric analysis diagram of nano C.v, ginger extract and nanocomposite.

 

 

Following the thermal decomposition curve, gasification occurred in the third stage with a weak peak at 370 °C and MW of 0.1. These results were similar to the results of Wang et al. [40]. In the third stage, only non-condensable gases such as CO, CO2, H2 and CH4 were released with a little weight loss. This might reflect that the necessary heat was directly proportional to the increased temperature, as almost all the volatiles in the microalga were released in the thermal decomposition zone. This could be understood due to the soft structure of microalga with a relatively low lignin concentration (7.33-9.55% wt), thus volatile substances were easily separated from the tissues. Compared to hardwoods with high lignin contents (25%) and complex textures, thermal decomposition of hardwoods over 600 °C still produced non-condensable gases, explaining its relatively high weight losses.

3.7. The 2,2-diphenyl-1-picrylhydrazyl  test

Ginger increases blood plasma antioxidant capacity and decreases lipid peroxidation and renal nephropathy in rats. Gunathilake et al. detected that 6-gingerol in ginger extract removed peroxide radicals and hence could be used as a natural food additive and a substitute for artificial antioxidants [51]. Antioxidant activities of the ginger extract and nanocomposite (GE@nano C.v, loaded with 0.5 mg mg ml-1 GE) were investigated for one month. As shown in Fig.8, antioxidant activity of the nanocomposite on the first day was nearly 60% at a concentration of 1.5 mg ml-1. This increased by ~2% within one month as a result of antioxidant characteristics of Chlorella, when GE adsorbed on the surface within the first week and then made the antioxidant agents of C. vulgaris available. Karaman et al. detected that the higher activity of inhibiting free radicals for the sample encapsulated in yeast cells was associate to the higher anti-radical contents of the yeast cells [52].

In a study by Ghasemzadeh et al., antioxidant activity of the methanol extract of ginger was reported as 51-58% at a concentration of 40 µg ml-1[53], possibly due to differences in the extraction method and various bioactive contents. In a study of Stoyanova et al., antioxidant activity of the ginger extract at 20 µg ml-1 was calculated as 90% [54]. In the study of Abdel Karim et al., C. vulgaris showed a 50% antioxidant activity with a concentration of 1.95 mg ml-1 due to the presence of plant chemicals (e.g., phenols, flavonoids, etc.) [55].

3.8. Antibacterial assay

Antibiotics are the compounds, which are used for human, animal and aquaculture treatments. Recently, their residues and degraded products in environment have included potential risks and toxicity worldwide. Antimicrobial activity against pathogenic and food-spoiling microorganisms is due to the bioactive compounds. Phenolic compounds such as gingerol and shogaol and their relationships majorly with other compounds such as β-sesquiphalendrene, cis-caryophyllene, zingiberene and α-farnesin are responsible for their antimicrobial activities in ginger essential oil and extract [56]. Hydrophobic residues of the ginger extract may interact with the lipophilic part of the cell membrane, disrupting their membrane integrity and function (e.g., electron transfer, nutrient absorption, protein and nucleic acid synthesis and enzymatic activity). In this study, results of the MIC assay showed that the ginger extract (Fig. 9a) and nanocomposite (Fig. 9b) included antibacterial charact-ristics and rates of their inhibition depended on their doses. By decreasing concentrations of the extract and nanocomposite, their antibacterial activities decreases. Concentrations of 1, 2 and 4 mg ml-1 of the extract and 6.25, 12.5 and 25 mg ml-1 of the nanocomposite were investigated.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 8. Antioxidant diagrams of the ginger extract (GE) and nanocomposite at concentrations of 0.5 and 1.5 mg ml-1, respectively. All data are expressed as the mean ±SEM. Statistical analysis was carried out using ANOVA (letters, p < 0.05). Charts with similar letters include no significant differences.

 

 

 

 Results of the antibacterial assay showed that absorption of the extract on the nanoparticle significantly decreased its antibiotic characteristics, which could be linked to the slow releases of the extract active compounds from the surface of the nanoparticles; however, this could be active for a longer time. Antibacterial activity of the ginger extract was due to its polyphenol compounds, especially zingibrene, gingerol and terpenoids [57]. Based on the study of Hussein et al., E. coli and S. aureus were susceptible to the active compounds of C. vulgaris at a high concentration of 100 mg ml-1. This could be due to the fatty acid contents, bioactive compounds, effects on cell cycle and protein and DNA syntheses or hydrophobic interactions that ultimately lead to cell leakage and death [58]. Inhibitory effects of the ginger extract on S. aureus, Pseudomonas spp. and E. coli was estimated as 90%. Inhibitory effects of nanocomposite on Salmonella spp. was higher than 60% and its effects on Pseudomonas spp. reached the maximum, increasing by ~6% for S. aureus to 50%. These differences could occur due to the structural differences in these bacteria [59].

3.9. Cytotoxicity assay

Ginger compounds (6-gingerol and its derivatives) have been shown to decrease hazards of several diseases, majorly in the gastrointestinal tract (GIT) and cancers such as carcinogenesis in the skin and breasts [60]. To assess cell viability of the breast cancer cell line (MCF-7) for their ability to decrease tetrazolium salt [3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide], various concentr-ations of GE, nano C.v and GE@nano C.v within 24, 48 and 72 h were investigated (graphs of 24 and 48-h assays not shown). Results showed outstanding cancerous-cell inhibitions by the nanocomposite (GE@nano C.v), compared to ginger extract and nano C.v. Based on the growth inhibition chart of the MTT assay in Fig. 10,

growth inhibitions of 67, 73 and 86%, were respectively reported after 24 h of incubation (37 ℃, 98% humidity, 5% CO2), with ginger extract at concentrations of 0.5, 0.75 and 1 mg ml-1,. After 48 h, this value reached 28, 46 and 84%, respectively, which indicated dose and time-dependent cytotoxicity of the three treatments, as the more concentration, the higher growth inhibition. Cell viabilities were inhibited by the ginger extract treatment during 48 h. After 72 h of adding GE, cytotoxicity effects on the breast cancer cells for the concentrations of 0.5, 0.75 and 1 mg ml-1 were 47, 48 and 47%, respectively. It was demonstrated that anticancer activity of the ginger extract decreased within 72 h. Various studies have shown effectiveness of the ginger extract on tumors. However, the extract not only includes therapeutic characteristics (due to 6, 8 and 10-gingerol and 6, 8 and 10-shogaol agents) but also decreases vomiting and nausea of the patients after chemotherapy [61]. In a study by Mohammed et al., further gingerol concentrations caused higher effects on cancer cell growth inhibition as 0.1 mg ml-1 gingerol included significant cytotoxicity for 24 h and 0.4 mg ml-1 gingerol showed 80% inhibition on MCF-7 cell line [62].

As previously stated, microalgae include bioactive compounds such as phytochemicals and carotenoids (lutein in C. vulgaris) with verified anticancer activities [63,64]. Cytotoxicity rates included 82, 75 and 76% after 24 h of treatment with nano C.v at concentrations of 0.5, 0.75 and 1 mg ml-1 that reached to 96, 77 and 67% after 48 h, respectively.

 

A

B

 

 

Figure 9. Graphs of the average inhibitory proportions of the ginger extract (GE) (a) and nanocomposite (b) on four bacterial strains of Salmonella typhi (black), Staphylococcus aureus (gray dotted black pattern), Pseudomonas aeruginosa (light gray-black pattern) and Escherichia coli (gray-black pattern) using MIC assay in three various concentrations with controls. Significant differences (mean ±SE) of the effects of concentrations on the bacteria is illustrated with letters at p <0.05.

 

 

 

 Growth rates of the cancer cells at 0.5, 0.75 and 1 mg
ml-1 respectively included 62, 62 and 67% after 72 h. This showed mild increases at 72 h, which could be due to the limited anticancer compounds in the cell wall of C. vulgaris microalga after grinding. Anticancer activities of the nanocomposite included 63, 63 and 71% after 24 h at 0.5, 0.75 and 1 mg ml-1, respectively. After 48 h from the addition of nanocomposite, these values included 74, 71 and 59% for the concentrations of 0.5, 0.75 and 1 mg ml-1 with significant changes, compared to those after 24 h, respectively. After 72 h at the concentrations of 0.5, 0.75 and 1 mg ml-1, growth rates of the cancer cells included 51, 54 and 53%, respectively. The maximum inhibitory effect could be seen at 1 mg ml-1 concentration of the nanocomposite due to the increases of ginger extract concentration adsorbed on nano C. vulgaris.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 10. Cell viabilities of the cancer cells (MCF-7 cells) after incubation in 0.5, 0.75 and 1 mg ml-1 ginger extract, nanoparticles of Chlorella vulgaris and nanocomposite (GE@nano C.v) with different significant values at p<0.05.

 

 

 

Anticancer activity of the ginger extract alone decreased after 72 h. However, activity of the nanocomposite increased and was set constantly, demonstrating preservation of the activity of ginger extract adsorbed on the surface of microalga. This is a significant advantage for the use of nano C.v as a carrier for GE.

  1. Conclusion

In this study, the synthesized nanocomposite included promising characteristics, which could be used in medicinal and nutritional industries. The HPLC assay showed bioactive compounds, especially 6-gingerol, in the extract (0.48 mg in 5 mg total extract). Furthermore, FTIR, TGA and DTA results verified adsorption of ginger extract on nano Chlorella surface. Due to intramolecular interactions of ginger with Chlorella chemical groups, improved thermal stability in range of 200-300 ℃ was observed. In addition, nanocomposite included a mild improved antioxidative activity within a month with 1.5 mg ml-1 concentration. Antimicrobial and anticancer assays indicated good effects on microbial and breast-carcinoma cell-line (MCF-7) growth at concentrations of 6.25 and 1 mg ml-1, respectively. In conclusion, combination of ginger and C. vulgaris could improve further antioxidant, antimicrobial and antitumor effects of ginger extract, compared to ginger extract alone. Further studies are needed to focus on novel methods for increasing adsorption of ginger extract on C. vulgaris cell wall to enhance nanocomposite stability.

  1. Acknowledgements

The authors acknowledge Prof. Ali Reza Zomorodipour from NIGEB, Iran, for his support to provide research instruments of cell culture. In addition, authors acknowledge the instrumental supports of the University of Tehran.

  1. Conflict of Interest

The authors declare no conflict of interest.

Antibacterial Activity of Lactiplantibacillus Strains Isolated from Commercial Yogurt against Foodborne Pathogenic Bacteria

Mona Othman Ibrahim Albureikan, Rawan Hassan Alshahrani

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e3
https://doi.org/10.22037/afb.v11i1.43275

Abstract

 Background and Objective: Lactic acid bacteria are well known as beneficial microorganisms and most of them are probiotic distributed widely, especially in fermented dairy products e.g. yogurt. This study aimed to isolate, characterize and assess antimicrobial effects of lactic acid bacteria producing bacteriocin-like inhibitory substances against foodborne pathogenic bacteria.

Material and Methods: In the present study, 17 lactic acid bacteria strains were isolated from 10 commercial yogurt samples and the antibacterial effects of lactic acid bacterial cell culture, cell-free supernatant and neutralized cell-free supernatant was assessed against standard foodborne pathogenic bacteria of Escherichia coli, Listeria monocytogenes, Klebsiella pneumonia and Salmonella typhimurium using agar well diffusion assay. Although various treatments were used, most of the lactic acid bacterial isolates showed antimicrobial activity against the foodborne pathogenic bacteria. Moreover, Lactiplantibacillus pentosus (SY1), Lacticaseibacillus rhamnosus (SY5), Lactiplantibacillus plantarum (SY8) and Lactiplantibacillus plantarum (SY9) showed significantly the best antimicrobial activity against the foodborne pathogens and thus were further identified using 16S rRNA gene molecular method.

Results and Conclusion: Results showed that four isolates could produce bacteriocin-like inhibitory substances, which was significantly effective to inhibit growth of the pathogens. Primary screening for antimicrobial activity showed that 10 lactic acid bacterial strains inhibited Escherichia coli. The results revealed that Listeria monocytogenes and Salmonella typhimurium was inhibited by six and one lactic acid bacterial isolates. Moreover, results showed that Klebsiella pneumoniae was not affected by the isolates or treatment methods. It is concluded that a bacteriocin-like inhibitory substance of lactic acid bacterial isolates was effective; hence, it could be used as a natural food additive to prevent foodborne infections and improve the food quality.

Conflict of interest: The authors declare no conflict of interest.

Ganoderic Acid Production via Aerial Co-cultivation of Ganoderma lucidum with Bacillus subtilis and Aspergillus niger Using Bubble Column Bioreactor

Soheil Kianirad, Dana Shakiba, Ashrafalsadat Hatamian, Zahra-Beagom Mokhtari-Hosseini, Hale Alvandi, Elham Ansari, Bahman Ebrahimi Hosseinzadeh

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e7
https://doi.org/10.22037/afb.v11i1.43684

Abstract

Background and Objective: Ganoderma lucidum, with its medicinal characteristics, is one of the most beneficial fungi in traditional Asian medicine. This fungus low efficiency of ganoderic acid production has limited its use as a valuable secondary metabolite. Environmental stresses and elicitors such as microbial volatile organic compounds in co-cultures can increase ganoderic acid production. To investigate effects of variables of co-culture time and volume on Ganoderma lucidum growth and ganoderic acid production, Bacillus subtilis and Aspergillus niger were aerially co-cultured with Ganoderma lucidum.

Material and Methods: To investigate fungus growth and production of ganoderic acid using bubble column bioreactor, effects of independent variables of temperature, initial inoculation, length-to-diameter ratio (L: D) and aeration were investigated using Taguchi method. Then, effects of co-culture of Ganoderma lucidum with Bacillus subtilis and Aspergillus niger under optimum conditions were investigated.

Results and Conclusion: Optimizing effects of co-culture time and volume variables led to 2.9-fold increases in production of ganoderic acid, compared to the control sample. Optimization of biomass production in the bioreactor showed that biomass production increased significantly by increasing the initial inoculation percentage and temperature. These two variables significantly affected ganoderic acid production and its optimum production point was 10% of initial inoculation, temperature of 25.6 °C, L: D of 4:8 and aeration rate of 0.64 vvm. Gas holdup investigation for air-water and air-fermentation media systems showed that the presence of suspended solids and aeration rate affected gas holdup. Microbial volatile organic compounds in co-culture of microorganisms can increase ganoderic acid production by Ganoderma lucidum.

Conflict of interest: The authors declare no conflict of interest.

Effects of Organic Solvents on Acceptor Reactions for Oligosaccharide Synthesis Catalyzed by Glucansucrase URE 13-300

Stanimira Angelova, Tonka Vasileva, Veselin Bivolarski, Ilia Iliev

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e9
https://doi.org/10.22037/afb.v11i1.43668

 

Abstract

 

Background and Objective: Glucansucrases from GH70 family are effective transglucosylases, able to use non-carbohydrate acceptors. Glycosylation of flavonoids or terpenoids increases their water-solubility and bioavailability. Enzymatic glycosylation by glucansucrases can be improved by addition of organic solvents to the reaction media. Thus, the aim of the study was to assess effects of menthol, carvacrol and thymol solubilized in organic solvents on the activity of glucansucrase URE 13-300 and transferase reaction.

Material and Methods: Several organic solvents were assessed for their effects on glucansucrase activity using DNS method. Kinetic parameters in presence of the most appropriate solvents were evaluated as well. Thymol, carvacrol and menthol were solubilized in DMSO and their effects on the enzyme activity was assessed. Dynamic of oligosaccharides synthesis in aqueous-organic media was investigated using high-performance liquid chromatography.

Results and Conclusion: Maltose-derived oligosaccharides synthesized by glucansucrase URE 13-300 showed degrees of polymerization from 3 to 6 in presence of organic solvents, as well as in presence of buffer alone. Their concentrations did not differ significantly in each of the reactions in aqueous-organic media. Furthermore, kinetic parameters showed adjacent Km values with 5% solvents compared to the control reaction in buffer. These findings revealed that the overall synthesis of glucooligosaccharides was not altered by the organic solvents, nevertheless they changed the product distribution throughout the transferase reactions. These moderate effects of the selected organic solvents were important requirement for the glycosylation of biologically active compounds for use in the food industry.

Conflict of interest: The authors declare no conflict of interest.

In-vitro Assessment of Antifungal and Antioxidant Activities of Olive Leaves and Fruits at Various Extraction Conditions

Jalal Hassan, Aghil Sharifzadeh, Sogand Moghadam, Hamid Hajigholamreza, Gholamreza Shams, Amirali Aghamohammadi, Kiandokht Ghanati

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e10
https://doi.org/10.22037/afb.v11i1.43655

Abstract

 

Background and Objective: Nowadays, there is a growing interest for use of plant-based products such as extracts in various industrial sectors. Therefore, optimization of conditions for ideal extraction of bioactive compounds is highly important. Olive leaves and fruits include biophenols, which can be used as natural antimicrobial and antioxidant agents. Therefore, extraction of these bioactive compounds can create value-added products, which can be used as natural preservatives in food industries. The aim of this study was to investigate effects of various extraction parameters (type of solvent, solvent volume, temperature, time and pH) on in-vitro antioxidant and antifungal activities of Iranian olive leaf and fruit extracts against five Candida species.

Material and Methods: Olive fruit and leaf extracts were achieved using maceration method at various extraction conditions. Antioxidant activity of the prepared extracts was assessed by cupric reducing antioxidant capacity method. The phenolic profile in olive leaf extract was assessed using high performance liquid chromatography. Antifungal activity of the olive leaf extract was assessed using disk diffusion method and minimum inhibitory concentration and minimum fungicidal concentration values.

Results and Conclusion: Results showed that the highest antioxidant activity was recorded in olive leaf extract prepared by 100 ml of 96% ethanol at pH 7 and 80 °C for 6 h. Moreover, HPLC analysis of the ethanolic olive leaf extract showed that oleuropein was the major compound of the extract. Antioxidant activity of the olive leaf extract was higher than that of the fruit extract in various conditions. Regarding antifungal activity, the olive leaf extract showed a higher activity, compared to olive fruit extract at all concentrations. In olive leaf extract, the highest (62.5 µg ml-1) and the lowest minimum fungicidal concentration (15.6 µg.ml-1) values were reported for Candida tropicalis and Candida albicans, respectively. The minimum fungicidal concentration of the olive leaf extract was 250 µg ml-1 for Candida albicans, Candida parapsilosis, Candida glabrata and Candida krusei and 500 µg ml-1 for Candida tropicalis. It can be concluded that olive leaf extract is a source of antioxidant and antifungal substances with potential uses in food industries.

Conflict of interest: The authors declare no conflict of interest.

Development of a Cost-Effective Culture Medium for the Bacterial Cellulose Production Using Food Industry Wastes

Maryam Nasresfahani, Valiollah Babaeipour, Mohammad Imani

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e11
https://doi.org/10.22037/afb.v11i1.43875

Abstract

 

Background and Objective: Use of bacterial cellulose has been interested in various industries, especially medical and pharmaceutical industries, due to its unique characteristics, compared to plant cellulose. However, bacterial cellulose production costs have limited its industrial uses, compared to plant cellulose. Decreasing costs of the culture media is one of the effective parameters for the industrial production of bacterial cellulose. This is the first report on combination of vinasse and glucose syrup as a bacterial cellulose culture medium.

Material and Methods: Two inexpensive culture media were developed for high-level production of bacterial cellulose based on food industrial wastes of corn steep liquor-glucose and vinasse-glucose syrups. Concentrations of glucose syrup and corn steep liquor as a culture medium and concentrations of vinasse and glucose syrup as another culture medium were optimized using response surface method with central composite design to maximize bacterial cellulose production yields.

Results and Conclusion: Under the optimal conditions after seven days, 14.8 and 13.3 g.l-1 dry bacterial cellulose were achieved in corn steep liquor-glucose syrup and vinasse-glucose syrup respectively. Yield of produced bacterial cellulose from these two cost-effective culture media was one of the highest values reported for bacterial cellulose. Furthermore, the produced bacterial cellulose was characterized using Fourier-transform infrared spectroscopy, X-ray diffraction and scanning electron microscopy.

Conflict of interest: The authors declare no conflict of interest.

Effects of Critical Storage Temperatures on Microbiological, Physico-chemical and Sensory Indicators of Sweetened Condensed Milk

Aleksandr Kruchinin, Elena Yurova, Bolshakova Ekaterina , Svetlana Turovskaya , Elena Illarionova, Irina Barkovskaya, Victoria Leonova

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e12
https://doi.org/10.22037/afb.v11i1.44478

Background and Objective: Principles of osmo and thermoanabiosis are used to produce sweetened condensed milks. Regarding their extended shelf lives, there are demands for their export to countries with various climates. However, high-positive and low-negative ambient temperatures during sweetened condensed milks transportation can affect their quality. Hence, it is important to study effects of critical storage temperatures on microbiological, physicochemical and sensory indicators of sweetened condensed milks.

Material and Methods: This investigation included a comprehensive study of the physicochemical, microbiological and sensory characteristics of sweetened condensed milks after storage under conditions involving multiple-stage and single-stage temperature changes within various ranges (from 5 to 50 °C; from 5 to -50 °C, from 50 to -50 °C and reverse cycles.).

Results and Conclusion: Analysis of samples subjected to cyclic changes, including multiple-stage heating for 9 d followed by multiple-stage cooling for 11 d, revealed that only viscosity changed relative to the control samples. In the reverse similar cycle (cooling to heating), formation of destabilized fat was observed. Moreover, changes of cycles and subsequent storage of the samples for 6 m led to increased viscosity, compared to control samples. It was established that single-stage freezing with a 14-d storage did not critically affect its quality. In contrast, rapid heating of the sweetened condensed milk up to 50 °C and storage under such critical conditions outside a cooled storage area were unacceptable. Further storage of samples subjected to cycles of single-stage freezing and heating for 6 m demonstrated a complete non-compliance with control samples for all parameters. Thus, sweetened condensed milk can be subjected to single-stage freezing to -50 °C and storage for 14 d, as well as multiple-stage cooling/freezing to -50 °C and multiple-stage heating to 50 °C following by cooling to 5 °C without loss of quality and safety during 6 m.

Conflict of interest: The authors declare no conflict of interest.

Effects of Adding Non-viable Lacticaseibacillus casei and Lactobacillus acidophilus on Physicochemical, Microbial, Chemical and Sensory Attributes of Probiotic Doogh

Saba Kamalledin moghadam, Mahdi farhoodi, vahid Mofid, Aziz Homayouni-Rad, Amir-Mohammad Mortazavian-Farsani, Ali Milani

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e14
https://doi.org/10.22037/afb.v11i1.44105

 

Background and Objective: Inactivated probiotics provide various health and technological benefits, making them appropriate for the production of functional dairy products. The aim of this study was to investigate effects of adding nonviable probiotics (Lactobacillus acidophilus LA-5 and Lacticaseibacillus casei 431) to doogh (a typical Iranian fermented milk drink).

Material and Methods: Probiotics were inactivated by heat or sonication and added to the samples before or after fermentation. Various parameters such as pH, titratable acidity, redox potential, antioxidant capacity, color, viscosity, and phase separation, viability of traditional starter bacteria and probiotics and sensory characteristics were assessed during fermentation and refrigerated storage at 5 °C.

Results and Conclusion: Sonicated probiotic-containing treatments included the highest pH decrease rate (0.011 pH min-1) during fermentation, as well as the highest antioxidant capacity (16.45%) and viscosity (35.15 mPa.s), while heat-inactivated probiotic- containing treatments included the lowest viscosity (17.60 mPa.s). Treatments with viable probiotics reasonably included the highest post-acidification rate during storage (4.14 °D d-1), compared to those containing nonviable cells, as well as the minimum phase separation rate. The b* and L* values of color did not differ significantly within treatments, but the highest a* value was observed in the treatments with sonication. The highest populations of Lactobacillus delbrueckii ssp. bulgaricus (log 11,891 cfu ml-1) and Streptococcus thermophilus (log 14,977 cfu ml-1) at the end of the storage were observed in treatments with heated probiotics (compared to viable probiotics) and treatments with sonicated probiotics, respectively. In addition, Lactobacillus acidophilus was more susceptible than Lacticaseibacillus case and included lower viability. Taste, mouth feeling and total acceptance of all samples did not differ significantly within treatments. The present study suggests that inactivated probiotics can successfully be used for the production of fermented milk beverages with appropriate sensory characteristics and higher antioxidant capacity, compared to the control group.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Recently, it has been suggested that probiotics, viable or non-viable, are bacterial cells that include positive effects on human health. By this general definition, probiotics are divided into two categories of viable and non-viable probiotics [1, 2]. The idea of using non-viable probiotics in food industries is originated from the fact that probiotic bacteria are susceptible to environmental conditions during passage through the gastrointestinal tract (GIT), include limited stability over a wide range of pH and temperature, include a shorter shelf-life and need refrigerated storage. Therefore, their use in various industries is further technologically and economically feasible [3-6]. Additionally, it has been verified that non-viable probiotics include beneficial effects for humans such as immunostimulating activity [7], cholesterol decrease [8], anticancer characteristics [9], healing gastrointestinal disorders [10] and suppression of pro-inflammatory cytokine production [11]. There are several available methods to inactivate probiotics, including heat treatment, ultraviolet (UV) irradiation, irradiation, sonication (ultrasound), high pressure, ionizing radiation, pulsed electric field (PEF), supercritical CO2, drying and changes in pH [8,12]. Sonication and heating are the most commonly used methods for inactivating probiotics, majorly because they are cost-effective and time-efficient. Ultrasound at frequencies of 20–40 kHz can be lethal to microorganisms by creating acoustic cavities on their cell membrane (CM), leading to the release of their contents [13]. In contrast, during heating, intracellular contents are not released.

Doogh is a fermented beverage whose major ingredients include yogurt, water, salt and flavoring agents [14]. However, studies on adding non-viable probiotics to fermented foods are limited. Parvayi et al. studied effects of inactivated Lactobacillus acidophilus ATCC SD 5221 and Bifidobacterium lactis BB-12 on yogurt characteristics and reported that incorporation of heat-inactivated probiotics to yogurts included less technological challenges and could be deliberated as an appropriate alternative for probiotics in functional yogurts [15]. Overall, there is still a research gap in the development and commercialization of inactivated probiotic dairy products in food industries. While interests in probiotics and prebiotics are increasing, inactivated probiotics have not received much attention for product development and market availability. In addition, knowledge on specific inactivated probiotic compounds in dairy products and their potential effects on human health is limited. Further research are needed to identify and characterize these compounds and assess their potential health benefits and uses in functional foods [16,17]. Moreover, there is a lack of standardized methods for the production and quality control of inactivated probiotic dairy products, which limits their widespread commercialization. Research in this area is essential to establish industry standards and guidelines for the production and commercialization of inactivated probiotic dairy products. The aim of this study was to assess effects of adding non-viable forms of Lacticaseibacillus casei 431 and lactobacillus acidophilus LA-5 probiotics inactivated by heating or sonication on the quality characteristics of doogh, a traditional fermented milk beverage from Iran. Probiotics were added before or after the milk fermentation processes.

  1. Materials and Methods
    • Materials

Skim milk powder was purchased from Pegah, Tehran, Iran. Starter culture included Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus (YF-3331) and the probiotics (Lacticaseibacillus casei 431 and Lactobacillus acidophilus LA-5) were provided by Chr. Hansen, Copenhagen, Denmark. De Man-Rogosa-Sharpe (MRS) agar and M17 agar were purchased from Quelab, Montreal, Canada, and salt from a local market.

  • Preparation of nonviable probiotics

Probiotic suspension was subjected to thermal inactivation by heating at 121 °C for 15 min [18].

To achieve ultrasound inactivation, probiotic suspension was exposed to ultrasound waves at a frequency of 250 kHz for 25 min [19].

  • Preparation of doogh

To prepare doogh, skim milk powder was reconstituted and diluted to a total solid content of 3.5%. Mixture was heated to 90 °C and set for 15 min before cooling down to 45 °C. Probiotics in viable or nonviable form were added before heat treatment (B) or after fermentation (A). Mixture was incubated at 42 °C until the pH reached 4.5, cooled down to 5 °C and stored in refrigerator for 28 d, as presented in Fig. 1.

  • Assessment of pH, redox potential and titratable acidity

The pH, RP (redox potential) and titratable acidity of the doogh samples were checked every 30 min during fermentation. After fermentation, doogh samples were cooled and stored in refrigerator for 28 d, during which, pH, RP (redox potential) and titratable acidity were assessed every 7 d to monitor the shelf life. The pH and RP were assessed using pH meter at room temperature (RM). Titratable acidity was assessed by titrating with 0.1 M NaOH solution and 0.5% phenolphthalein indicator [20]. Increase in acidity, decrease in pH value (pH value min-1) and increase in redox potential (mV min-1) were calculated using Eqs. 1, 2 and 3:

Figure 1. Study design of the present study.

 

  • Serum separation analysis

After cooling down, samples were stored in 10 ml vials and incubated at 5 ºC to assess serum separation. During the shelf-life period, height of the supernatant was assessed every 7 d to assess degrees of serum separation that were expressed as proportions using the following Eq. 4 [21]:

 

                Eq. 4

  • Rheological assessment

Rheological assessments were carried out using Brookfield viscometer at refrigerator temperature, one day after the samples were prepared [22]. Briefly, no. 2 cylindrical spindle and spindle speeds of 0.3, 0.6, 1.5, 3, 6, 12, 30 and 60 rpm were used during 90 s if the torque to rotate the spindle in the samples was between the 15.0 and 85.0% of the maximum torque.

  • Assessment of antioxidant capacity

To assess antioxidant capacity of the samples, a method was used based on the ability of antioxidants to scavenge the stable radical DPPH (1,1-diphenyl2-picrylhydrazyl). This method was described by Farahmandfar et al. essentially, sample ability to reduce the concentration of DPPH was assessed by measuring absorbance of the solution before and after exposure to the samples [23]. Antioxidant capacity of all samples and inactivated bacterial suspension were assessed on two occasions. The first assessment was carried out on the day of production, while the second assessment was carried out on Day 28 of the shelf-life.

       Eq. 5

  • Color assessment

Color characteristics of doogh were assessed using Hunter Lab Color Flex EZ explained by Milovanovic et al. [24]. Color parameters were L* (brightness, white = 100, black = 0), a* (+, red; -, green) and b* (+, yellow; -, blue).

  • Bacterial enumeration

Pour plate method was used to count numbers of L. delbrueckii subsp. bulgaricus, S. thermophilus and L. casei [25]. The L. bulgaricus, starter bacteria of doogh, was cultured in MRS-bile agar at 42 ºC for 72 h under anaerobic conditions using Gas Pac system. Enumeration of S. thermophilus was carried out using M17 agar at 37 ºC for 24 h under aerobic conditions [26]. Lactobacillus acidophilus LA-5 and L casei were cultured in MRS agar with added bile (0.15% w w-1) to prepare selective media of probiotic enumeration at 37 ºC for 72 h under aerobic conditions [27, 28]. The initial counts of L. acidophilus and L. casei were 107 CFU ml-1. To calculate the viability proportion index, final cell population of the microorganisms was divided into the initial cell population based on the Eq. 6 [25].

                                                           Eq. 6

  • Sensory evaluation

Taste, mouth feel and overall acceptance of doogh were assessed using 5-point hedonic scale rating test (with 5 excellent, 4 good, 3 acceptable, 2 bad and 1 very bad) [29]. Twenty consumers assessed the sensory attributes of doogh samples after the first day of preparation.

  • Statistical analysis

All experiments were carried out in triplicate and expressed as mean ±SD (standard deviation) (n = 3). Data were analyzed using univariate analysis of variance (Tukey test) AND SPSS statistical software v.26 (SPSS, Chicago, USA). Generally, p < 0.05 was addressed as the significance threshold.

  1. Results and Discussion
  • Assessments of pH, redox potential and titratable acidity

During milk fermentation, growth of starter bacteria leads to the conversion of lactose into various compounds such as lactic acid, acetate, formate, acetaldehyde and ethanol. This process results in lactic acid production, causing decreases in pH and increases in redox potential and titratable acidity [30]. Figure 2 illustrates changes in pH, redox potential and titratable acidity during the fermentation process. The initial pH of milk at the beginning of fermentation was 6.8, dropping to 4.5 by the end of fermentation. As shown in Fig. 2, and Table 1 fermentation process included three distinct phases of lag, log and constant phases. During the first 30 min, the lag phase, no significant changes were seen, possibly due to the adaptation of the starter bacteria and buffering characteristics of milk [31]. The fastest decrease in pH and increase in redox potential were observed in sample with ultrasound-inactived L. casei. This might be attributed to the ultrasound treatment, which caused puncturing of the membrane of the probiotics, resulting in the release of their cell contents into doogh [5,13]. Feeding the starter bacteria resulted in decreases in the rate of pH and pH of BUC reached 4.5 as the fastest rate (after 210 min). However, BUA included the highest titratable acidity, indicating that the type of probiotic bacteria included major effects on the rate of pH drop and acidity increase. Similarly, Tian and colleagues (2017) reported that the type of bacteria included effects on the quantification of organic acids [32]. In addition, postbiotics produced from L. acidophilus LA-5, L. casei 431 and L. salivarius included 62 vrious components, including alcohols, terpenes, norisoprenoids, acids, ketones and esters [33]. Hence, these compounds were available in the environment and might improve the fermentation stage.

Based on Fig. 2, BHC included similar rates of pH decrease and increase in redox potential through the fermentation process as the sample without probiotics. However, BHA showed the lowest rate of acid increase at the end of the fermentation, indicating that the starter bacteria alone were responsible for lactic acid production and the intact cells of the probiotic bacteria included no significant effects on acid production. Furthermore, heat-inactivated L acidophilus demonstrated the antibacterial activity [34]. Samples containing live probiotics needed longer times (240 min) to reach pH 4.5. This finding was similar to the finding of Parvayi (2021), who reported that live probiotic samples needed longer times to reach pH 4.5, compared to paraprobiotic samples [15]. Based on a study by Vinderola et al. (2002), adding L. casei and L. acidophilus to the media with the starter bacteria included negative effects on the growth of the starter bacteria, resulting in decreases in lactic acid production [35].

Statistical analysis showed no significant differences in redox potential between various types of bacteria (p>0.05). However, L. acidophilus resulted in further decreases in pH and increases in titratable acidity during the storage, compared to that L. casei did (p<0.05) as represented in Table 2. These results suggested that the selection of probiotic bacteria should carefully be considered based on the specific goals of the fermentation process [36]. Throughout the storage, the highest level of titratable acidity was seen in sample containing live probiotics of L. acidophilus (181AD∘), which could be attributed to the ongoing acid production by the live probiotics at the refrigerated storage. In contrast, BUC sample included the lowest acidity (117A), suggesting that the addition of probiotics after the fermentation process could lead to uncontrolled increases in acidity and continued fermentation during cold storage [15]. Moreover, samples containing sonicated and live probiotics included the maximum and the minimum RP increasing rates because of producing the minimum and the maximum lactic acid quantities during storage (p<0.05).

  • Serum separation

The study detected that the activity of starter bacteria and their ability to generate acids included significant effects on the separation of serum in the samples [37]. Data of Table 3 show increases in serum separation values for all samples during the storage. The initial and the final separation rates of BUC were the highest (32.4%), suggesting that the released intracellular contents were heavier than the whole bacterial cells, causing further sedimentations. In addition, Samples containing live probiotics included smaller serum separation ratios at the end of storage, indicating that they frequently produced lactic acid and their pH was further different from the isoelectric pH [38].

Relatively, Amani et al. reported effects of the activity of starters during storage due to their protein hydrolyzing characteristics on phase separation [37]. In addition, L. casei was reported to include lower serum separation ratios than that L. acidophilus did (p<0.05). This suggested that the type of bacteria in the samples played important roles in the serum separation rate because various strains of probiotic bacteria included various abilities to ferment and break down organic compounds and producing exo-endo polysaccharides as discussed in viscosity section [39]. However, np statistically significant differences were detected between the sequences of probiotic additions (p> 0.05).

  • Viscosity

Naturally, acidification and lowering of pH during fermentation cause milk casein proteins to clump, affecting viscosity of the final products. Figure 3 shows assessed viscosity of the samples. Sonicated probiotic-containing treatments (BUC and BUA) included the highest viscosity (3.083 ±0.6 and 3.515 ±0.5, respectively). Additionally, addition of live probiotics during fermentation led to increased viscosity, compared to samples without probiotics. It was reported that the release of exopolysaccharides and intracellular polysaccharides from the probiotics significantly increased viscosity [40, 41]. Exopolysaccharides secreted by Lactobacillus spp. during their growth affect viscosity of dairy products [42]. Moreover, "intracellular polysaccharides" are polysaccharides that accumulate within cells. The intracellular biosynthetic process involves transferring sugar residues into the cell, converting them into various monomeric units, partially polymerizing them and attaching them to isoprenoid lipid carriers [43]. Viscosity of heat-inactivated treatments was similar to that of control treatment, possibly because intact cells of probiotic bacteria did not release biopolysaccharides into doogh samples. Furthermore, type of bacteria significantly affected the viscosity (p<0.05). It was previously reported that variations in the viscosity values could be affected by characteristics of the probiotics cultures as well as adaptability of the bacteria [44].

  • Antioxidant activity assessment

The DPPH radical scavenging method, widely used to assess antioxidant activities, is simple, rapid, sensitive and reproducible compared to other methods [45]. Figure 4 shows antioxidant capacities of the samples on Days 1 and 28. Antioxidant capacity of the samples decreased significantly during the storage due to inappropriate sealing, oxygen entry into the samples and uncontrolled bacterial activity. Sonicated probiotic-containing treatments increased the antioxidant capacity, as the intracellular content of lactic acid bacteria (LAB) demonstrated greater antioxidant characteristics than that the whole cell or the extracellular metabolites did [46,47]. Antioxidant activity of the intracellular contents of LAB was linked to the activity of superoxide dismutase (SOD), glutathione peroxidase (GPx), nicotinamide adeninedinucleotide (NADH)-oxidase, NADH-peroxide and glutathione (GSH) enzymes [48]. In addition, use of live or heat-inactivated probiotics did not result in significant differences (p>0.05). This was due to the cell contents that were not released. Relatively, lyophilized cells of Lactococcus lactis subsp. cremorishave included the highest antioxidant capacity, compared to those the heat-killed and intact cells did [49].

In contrast, use of L. acidophilus rather than L. casei significantly increased the antioxidant capacity (p<0.01). Amdekar et al. assessed antioxidant and anti-inflammatory potentials of L. casei and L. acidophilus in in-vitro models of arthritis. Results indicated that arthritic rats treated with L. acidophilus included higher glutathione peroxidase and decreased glutathione concentration, compared to that arthritic rats treated with L. casei did [50]. Additionally, adding probiotics before fermentation improved the antioxidant capacity of doogh samples (p>0.05).

  • Color analysis

 

Color is a critical characteristic in assessing quality of products such as yogurts and doughs. The L* parameter indicates lightness or darkness of the color, the a* parameter shows redness or greenness of the color and the b* parameter represents yellow or blueness of the color [51]. The color values are shown in Fig. 5. Integration of probiotics inactivated using ultrasound resulted in increases in a* value, indicating release of probiotic contents into the doogh sample (p<0.05) and showing that green pigment substances such as thiamine were present in intracellular probiotics [52]. However, no significant differences were reported between the paraprobiotics and probiotics in a* value (p>0.05). Additionally, no significant differences were demonstrated between the sequential additions of probiotics in a* value (p > 0.05). Type of the probiotics in doogh samples included significant effects on a* value (p < 0.05). It has previously been suggested that various types of bacteria with special characteristics can affect color of the products [53]. In L* and b* values, no differences were observed within the addition of active/inactivated probiotics into doogh samples (p>0.05). Furthermore, types of probiotic bacteria (L. casei or L. acidophilus) and probiotic adding sequences did not include significant effects on L* and b* values (p > 0.05).

  • Viable counts of the starter bacteria and probiotics

The L. bulgaricus and S. thermophilus are critical for acidification and production of doogh [54]. Survival of the starter and probiotic bacteria in yogurts depends on various factors such as the specific strains, interactions between the species, chemical compositions of the yogurts, the culture conditions, production of hydrogen peroxide during bacterial metabolism, final acidity of the yogurts, rates of lactic and acetic acids, nutrient availability and the storage temperature [46]. Table 4 shows the number of L. delbrueckii subsp. bulgaricus and S. thermophilus for all samples during the storage. The BUA included the highest number of L. delbrueckii subsp. bulgaricus on the first and the last days of enumeration (logs 11.89 and 10.91 cfu ml-1, respectively), while BC included the lowest number (logs 11.35 and 9.68 cfu ml-1, respectively). Additionally, BA and BUA included the lowest and the highest L. delbrueckii subsp. bulgaricus counts at the end of storage (logs 7.84 and 10.91 cfu ml-1, respectively). Type of probiotics (viable or non-viable) in doogh samples included significant effects on the viability of L. delbrueckii subsp. bulgaricus (p<0.05) through competitive interactions, metabolic activities, cell-cell interactions and protective effects. However, a study by Parvayi et. al (2021) showed that addition of viable or non-viable probiotics did not affect L. delbrueckii subsp. bulgaricus when used as the starter bacteria [15].

As a statistical result, significant differences were observed between using L. casei and L. acidophilus probiotic bacteria (p<0.05). Selection of probiotic strains such as L. casei and L. acidophilus in doogh could affect viability of L. delbrueckii subsp. bulgaricus through species-specific interactions, metabolic compatibility, competition for resources, synergistic or antagonistic effects and stability of the microbial community. In addition, inhibition of L. delbrueckii subsp. bulgaricus growth by L. acidophilus has previously been reported. Vinderola reported L. casei strains did not include effects on the growth of L. delbrueckii subsp. bulgaricus [35]. Furthermore, no statistical differences were reported between the sequences of adding probiotics (before or after fermentation) into doogh samples (p>0.05). In contrast, viability of S. thermophilus decreased significantly (p<0.05) during the storage. On the first day of storage, BUC included the highest number of S. thermophilus (log 14.67 cfu ml-1), whereas BA included the lowest number of S. thermophilus (log 13.54 cfu ml-1). In addition, AA and AUC included the lowest and the highest S. thermophilus counts at the end of storage (logs 10.11 and 12.85 cfu ml-1, respectively). The highest rate of decrease in S. thermophilus viability was associated to AA (0.73), while AUA included the lowest rate of decrease in S. thermophilus viability (0.88). Addition of non-viable probiotics caused significant differences in the bacterial population, compared with that addition of live probiotics did (p<0.05). This could be due to the indirect antagonistic effects of live probiotics [4, 35].

Doogh samples with inactivated probiotic cells showed significantly higher starter proliferation, compared to those treated with probiotic bacteria due to the cell wall structure of L. acidophilus and L. casei in their ruptured cells (p<0.05). Naturally, cell wall majorly consists of teichoic acids, cell structural protein (S-layer), peptidoglycan and polysaccharides [10]. Additionally, LAB intracellular contents include GABA, B-vitamin complex, polysaccharides, biopeptides, polysaccharides and lipoteichoic acids [4,47,55]. Therefore, fermentation in the environment is strengthened when the intracellular contents are released into doogh. It is possible that choosing the right time for inoculation can significantly affect growth of starter bacteria. Results showed significant differences (p < 0.01) between adding probiotics before or after the fermentation process, affecting viability and activity of the starter bacteria due to its adaptation to the culture medium during fermentation and storage. Moreover, it was reported that L. acidophilus included stronger growth inhibitory effects on S. thermophilus than that L. casei did (p <0.01). In a study by Vinderola et. al (2002), L. casei strains inhibited growth of S. thermophilus while L. acidophilus did not affect the growth of S. thermophilus [35]. Sample inoculated with live probiotics before fermentation included the lowest count of S. thermophilus due to the potential antagonism effects of the probiotics (p<0.01).

Generally, live probiotics included side effects on the growth and viability of the starter bacteria. For nonviable probiotic cells, these inhibitory effects are rarely observed and can surprisingly promote starter bacterial activity by providing various nutritious (e.g., amino acids, minerals, B vitamins and saccharides) and growth stimulatory elements [56]. Moreover, live probiotic bacteria include side effects on the starter bacterial growth because of their antimicrobial secretion and competition. Probiotic bacteria included more inhibitory effects on LAB than that LAB did when probiotics were not present [35]. For inactivated probiotics, there are no severe competitions for nutrition between the starter bacteria that may nourish them and enhance their growth due to the release of cytoplasmic contents. It is noteworthy that addition of live probiotics to media before fermentation increased the number of probiotic cells during storage due to better adaptation (p < 0.05). Furthermore, L. acidophilus was more susceptible than L. casei and statistically significant differences were recorded in viability of the probiotic bacteria (p < 0.05). Therefore, it can be concluded that selection of an appropriately adaptable strain may play critical roles in preserving viability of probiotics during the shelf life of the products [36].

  • Sensory evaluation

Sensory attributes play key roles in attracting consumers. Daily probiotic products may include distinct tastes that are not be accepted by the consumers [57]. Therefore, studies have focused to improve consumer acceptance of probiotic beverages. In this study, taste, mouthfeel and overall acceptability of sensory aspects were assessed on the first day of fermentation (Figure 6). The AHC included the highest score (4.1/5) for taste, while AC included the lowest score (2.6/5) due to uncontrolled lactic acid formation. Nevertheless, no significant differences were seen for taste, mouthfeel and total acceptance of doogh samples (p > 0.05). A study demonstrated that probiotic beverages containing L. casei included high acceptance, compared with beverages containing L. acidophilus due to desirable flavors [58].

  1. Conclusion

These non-viable probiotics have been shown to eleminate technological limitations by enhancing rates of titratable acidity and fermentation, texture, viability of starter bacteria including S. thermophilus and L. bulgaricus and decreasing post-acidification rate as well as potentially improving gut health and immunity by increasing antioxidant capacity of doogh samples. Further studies are needed to fully understand mechanisms of these effects and optimize formulation of non-viable probiotics in fermented milk products. Overall, findings suggest that incorporating non-viable probiotics into fermented milks can be a valuable strategy for enhancing functional characteristics of dairy products.

  1. Acknowledgements

Please write one paragraph

  1. Conflict of Interest

The authors report no conflicts of interest.

Production of Nanocomposite Silver Packaging using Solution Blending Method for the Supplement of Antibacterial Coating

Zahra Taati Jafroudi, Hamed Ahari, Nekisa Sohrabi Haghdoost, Shahrokh Shabani

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e16
https://doi.org/10.22037/afb.v11i1.43876

 

Background and Objective: The objective of this study was to assess antimicrobial effects of silver nanoparticles on Gram-positive and Gram-negative bacteria that used in preparing silver nanocomposite with the antibacterial characteristics using solution method. Moreover, the aim of the current study was to produce antimicrobial silver nanocomposites for food coating with their effects on a wide range of bacteria.

Material and Methods: To assess antibacterial characteristics of silver nanoparticles, several steps were carried out. First, nanoparticles were synthesized through a chemical reduction method using NaBH4 and then analyzed using x radiation diffraction, ultraviolet and visible spectroscopic analysis, dynamic light scattering and scanning electron microscopy nanometric assays. Then, Staphylococcus aureus and Escherichia coli were used as Gram-positive and Gram-negative bacterial indicators. Minimum inhibitory concentration, minimum bactericidal concentration and inhibition zone levels were measured. Nanocomposite was produced using solution blending method and its antibacterial characteristics were assessed using inhibition zone method.

Results and Conclusion: Results indicated that silver nanoparticles with 20 and 50 µg.l-1 concentrations included inhibitory effects on Staphylococcus aureus and Escherichia coli, respectively. Furthermore, concentrations of 40 to 60 mg.l-1 included lethal effects on Staphylococcus aureus and Escherichia coli, respectively. Based on the results, the highest antibacterial effects were observed on Gram-positive Staphylococcus aureus. In inhibition zone assays, a 3-5 mm zone was seen around the silver nanoparticle discs in cultures of the microorganisms. In the inhibition zone assay of the produced nanocomposites, the zone was expected regarding the concentrations. Results were calculated in three repetitions and the value estimated through ANOVA was significant when p<0.0001. It has been concluded that silver nanoparticles are useful in Gram-positive and Gram-negative bacteria for the inhibition and destruction. Moreover, it has been verified that using the method includes great effects on antibacterial characteristics of the nanocomposites.

Conflict of interest: The authors declare no conflict of interest.

 

 

*Corresponding authors:

 

Hamed Ahari *

Food Biotechnology, Tehran Science and Research Branch, Islamic Azad University, Tehran, Iran

 

Tel: +98-9121872334

 

E-mail:

dr.h.ahari@gmail.com

 

 

  1. Introduction

 

In recent years, use of metal nanoparticleshas increased due to the resistance of pathogenic microorganisms (bacteria, fungus and viruses) against conventional antimicrobials. General concerns on the safety and quality of foods, particularly marine foods, during storage and stocking have led the microbial growth control a fundamental part of the distribution and storage chain of such products [1-4]. Based on various studies and assessment of silver nanoparticle function mechanism against microorganisms, their use as antimicrobial agents, especially in the food and medical industries, can be one of the novel solutions for conquering problems caused by the pathogenic microorganisms. Food products are infected by various microbial agents during production processesss. Infections may occur in formulation of ingredients, using chemical additives and posing high pressure and flash pasteurization. Harmful materials likely enter food formulation during this process, or chemical reactions may occur with dangerous outcomes to humans.

If food products are in contact with contaminated surfaces or surfaces with metal ions during the production processes, this can endanger consumers’ health. Therefore, use of proper antimicrobial packaging based on bio-polymers is nowadays highly interested due to being biodegradable, lack of collection of various synthesized materials in the natural ecosystem and improvement of mechanical and viscoelastic characteristics as well as appropriate antimicrobial characteristics [5]. Liao et al. studied the antibacterial activity and action mechanisms of silver nanoparticles (AgNPs) against Pseudomonas aeruginosa resistant to several medicines. In that study, use of morphological changes and assessment of active oxygen and activity of enzymes in the bacteria when exposed to AgNPs as well as reporting minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) showed the potential antibacterial effects of AgNPs on the bacteria [6]. Jo et al. investigated antibacterial characteristics of polyethylene and polypropylene nanocomposite films using AgNPs. First, nanocomposites were prepared using melting method and extruder. Based on the results, these nanocomposites included a 99.9% destructive effect on Staphylococcus aureus and Escherichia coli bacteria. This result showed well that using these nanocomposites could be effective and efficient in food packaging [7]. Furthermore, researchers synthesized degradable films with mixed clay and polyvinyl alcohol (PVA). They used these films against essential food pathogens such as Salmonella typhimurium and Staphylococcus aureus. Their results could reflect high antimicrobial effects of these nanoparticles, their mechanical characteristics and appropriate flexibility caused by PVA, as well as biodegradability of these films, which were verified through burring assaessment of them in the ground. To show efficiency of the highlighted packaging bags, shelf life of the chicken sausage samples was compared with that of regular polyethylene bags. Results showed enhancements in shelf life by decreasing microbial loads [7].

Mathew et al. synthesized nanocomposites, combining clay and biodegradable PVA. Based on their findings, the combined nanocomposite films included sufficient antimicrobial characteristics against food pathogens such as S. typhimurium and S. aureus and higher mechanical characteristics such as resistance against water and light transmission, compared to control films. The soil burial assay revealed that the nanocomposites degraded within 110 d and hence were considered biodegradable. Then, nanocomposite combined films were included in the bags used for keeping chicken sausages, which resulted in decreases in microbial loads compared to the control polyethylene bags and were much more effective in increasing shelf life of the chickens [8]. Findings from their study were similar with those of the the current study.

Liao et al. studied antibacterial characteristics and mechanisms of AgNPs against P. aeruginosa resistant to drugs. In this study, antimicrobial effects of AgNPs on resistant clinical isolates against P. aeruginosa with MIC and MBC were investigated. Morphological changes were observed in P. aeruginosa resistant against drugs under transmission electron microscopy (TEM). Distinct protein highlighted in the proteomics approach was studied quantitatively and production of reactive oxygen species was assessed using 2′,7′-Dichlorodihydrofluorescein diacetate (H2DCFDA) coloring. Activity of superoxide dismutase (SOD), catalase and peroxidase was chemically assessed and apoptosis effects were studied through flow cytometry. Findings revealed that AgNPs included strong inhibitory effects on P. aeruginosa resistant against the antimicrobials with MIC of 1.406-5.625 mg.ml-1 and MBC of 2.81-5.62 mg.ml-1. Results of TEM revealed that AgNPs could penetrate resistant bacteria and disrupt their structure. Furthermore, quasi-apoptosis in bacteria affected by AgNPs was significantly higher. General findings and the estimated p-value (p<0.01) revealed strong antibacterial effects of AgNPs on multiresistant P. aeruginosa [9]. Active packaging incorporating AgNPs becomes popular due to its efficacy in combating foodborne pathogens. This technology uses AgNPs directly embedded in the packaging materials or adsorbed as ions, offering a safe effective antimicrobial shield. Recent approvals by the European Food Safety Authority (EFSA) for specific silver compounds further facilitates broader implementations [10].

This study investigated antibacterial effects of AgNPs on Gram-positive and Gram-negative bacteria and produced silver nanocomposites with appropriate antibacterial characteristics using solution blending. As previously stated, the present experimental study investigated use of AgNPs synthesized via chemical resuscitation method by assessing their MIC, MBC and inhibition zone against S. aureus, E.coli and Candida albicans, leading to decreases of food spoilage and enhancement of food shelf life. Moreover, their antimicrobial effects were studied as alternatives to antimicrobials.  The aim of this study was to investigate antibacterial effects of AgNPs on Gram-negative and Gram-positive bacteria and produce silver nanocomposites with appropriate antibacterial characteristics using solution blending method.

  1. Materials and Methods

2.1. Synthesis and characterization of silver nanoparticles

The AgNPs were synthesized using chemical reduction method with sodium borohydride (NaBH4). Dynamic light scattering (DLS) verified the particle sizes within the desired range of 25-40 nm. The X-ray diffraction (XRD) analysis revealed crystal structure of the materials, while UV-VIS spectroscopy provided information on nanoparticle size and homogeneity. Additionally, scanning electron microscopy (SEM) visualized morphology of the synthesized nanoparticles.

2.2. Antimicrobial activity assessment

Culture media and autoclaves were sterilized. Each experimental tube included 5 ml of culture media, 100 mg of bacteria/fungi and calculated concentrations of AgNPs. Triplicate experiments were carried out.

2.3. Minimum inhibitory concentration and minimum bactericidal concentration assessments

Microdilution assay in gamma tubes was used. Nutrient broth was used for S. aureus and E. coli and Sabouraud dextrose (SD) broth for C. albicans. Standardized inocula (100 μl) were added to the broths and incubated at 37 °C for 24 h. The MIC was assessed as the lowest concentration inhibiting visible growth. The MBC included plating 100-μl aliquots onto agar media (nutrient agar for bacteria and SD agar for fungi) and incubating at 37 °C for 24 h. Moreover, MBC was defined as the lowest concentration demonstrating no microbial growth or less than three colonies (99-99.5% killing).

2.4. Nanoparticle synthesis method

First, sodium borohydride was dissolved in water (ice bath) and mixed with polyvinylpyrrolidone (PVP). Silver nitrate solution was then added to the mixture, which changed the color from yellow to orange, brown and then black. This was then stirred quickly (~1500 rpm) at 50–60º C, which created clods. Drops of silver nitrate (0.001 M) were added to sodium borohydride (0.002 M) set in the ice bath, which changed color of the final product to yellow. This color became darker over time. To increase stability of the product, 1% PVP was added to the solution, which changed color of the product to pale orange-red. Concentration of the colloidal nanosilver was 6 mg.ml-1 and based on the UV-VIS assay, size of the particle was 25–40 nm. The quantity of PVP used for increasing stability was 3 mg.ml-1.

2.5. Nanocomposite production through solution blending

In brief, 500 ml of the polymer PVA were divided into five beakers with volume of 0.28, 0.42, 0.83, 1.67 and 2.5 ml. Then, AgNPs were added to 12.5 25, 50, 100 and 150 ml with a concentration of 6 mg.ml-1. These were stirred on a stirrer heater at 50 ºC for 24 h until volume of the solution reached 20 ml. The final product was poured into a Petri dish and set in the oven for 24 h to dry. Then, the final composite with similar thickness and appropriate level of flexibility was ready.

2.6. Analysis of the size of nanoparticles using dynamic light scattering method

In general, DLS is a technique used to assess particle sizes in solutions and suspensions. In this method, specialized devices analyze the motion of particles while they are suspended in a liquid. It provides a rapid and non-destructive way to assess particle sizes, ranging from nano to micrometers. For example, researchers transferred nanosilver colloids into the DLS device cell. The subsequent analysis estimated the particle size. Specifically, 5 ml of nanosilver colloid were analyzed at 25 °C with a laser strength of 60%.

2.7. UV-VIS analysis

Characteristics of photons on samples and measuring the rate of passage or absorption (rate of adsorption or reflectance of light) in various wavelengths ranging 200-1100 nm. Results of the assay were presented in a typical surface absorption plasmon at 420 nm  achieved from the AgNPs.

2.8. Scanning electron microscopy analysis

The SEM is an exceptionally well-suited method for the study of nanoparticle structure and it depicts the size of AgNPs in ranges from 10 to 100 nm. No agglomeration was seen in nanoparticles, showing stabilization of the nanoparticles.

  1. Results and Discussion

3.1. Analysis of the nanoparticle characteristics

The DLS results from Fig. 1 (a, b, c) revealed essential information on AgNPs. Based on the figure, AgNPs demonstrated the following characteristics. Number distribution, approximately 41% of the particles within specific size ranges; volume distribution, nearly 48% of the particles contributing to the overall volume; intensity distribution, significantly 92% of the scattered light intensity originating from the specific particle sizes.

Additionally, Fig. 2 shows a SEM image of AgNPs synthesized through chemical reduction. These nanoparticles exhibited spherical shapes and included a size range of approximately 25 to 40 nm.

Furthermore, Fig. 3 presents the UV-VIS diagram, providing further characterizations of the AgNPs. To assess structural characteristics of the nanocomposite films, XRD analysis was used. Nanosilver samples were irradiated with Cu-Kα radiation (λ = 54.1 Å) using X-ray spectrometer operating at 40 kV and 30 mA. The resulting XRD pattern provided valuable information on the crystalline phases and crystallographic orientation within the nanocomposite films (Fig. 4).

 

 

 

 

  1. Nanoparticles with a size of 145.8 nm

Figure 1. Dynamic light scattering diagram of the produced silver nanoparticles with various sizes: a, 121.9, b, 145.8 and c, 150.3

 

 

 

 

 

Figure 2. Scanning electron microscopy of the silver nanoparticle synthesis using NaBH4

 

Figure 3. The UV-VIS diagram of the produced silver nanoparticles

 

 

 

 

 

 

Figure 4. The X-ray diffraction diagram of the produced silver nanoparticles

 

 

 

3.2. Minimum inhibitory concentration and minimum bactericidal concentration assessments

The MIC and MBC of the biosynthesized nanoparticles were assessed against various pathogens. Nanoparticles showed potential antibacterial activities against E. coli (MIC, 50 µg.ml-1 and MBC, 70 µg.ml-1) and S. aureus (MIC, 25 µg.ml-1 and MBC, 45 µg.ml-1). However, nanoparticles demonstrated weaker antifungal activities against C. albicans (MIC, 350 µg.ml-1 and MBC, 380 µg.ml-1). Results suggested potentials of these nanoparticles as broad-spectrum antimicrobials. Although further optimizations may be necessary for the enhanced antifungal efficacies (Fig. 5).

3.3. Antimicrobial susceptibility assay for the assessment of inhibition zone diameters (disk diffusion)

To assess antibacterial and antifungal activities of the AgNPs, inhibition zone assay was used via diffusion disks impregnated with various concentrations (200 and 6000 µg.ml⁻¹). Three microorganisms were assessed, including S. aureus, E. coli and C. albicans. Isolated bacterial colonies of S. aureus and E. coli were suspended in sterile serum, creating a homogenous solution. This solution was then streaked onto agar plates using sterile swabs. Blank disks loaded with either AgNPs or control antibiotics (amikacin for bacteria and itraconazole for fungi) were transferred onto the inoculated plates. Following incubation at 37 °C for 24 h, diameters of the resulting inhibition zones around the disks were measured using caliper. For the nanocomposite disks, another experiment was carried out, where blank disks were punched out and loaded with various nanoparticle concentrations. These disks were then added to the bacterial cultures and the inhibition zones were measured as described. Results of this study provided information on the potentials of the AgNPs as antimicrobial agents against various pathogens (Table 2).

Findings of MBC and MIC assays verified that by prohibiting microorganisms, AgNPs could increase the shelf life of foods (Table 1). Results revealed the higher effects of AgNPs on Gram-positive S. aureus, compared to Gram-negative E. coli. According to Abbaszadegan et al., the major reason for differences in antibacterial effects of Gram-positive and Gram-negative bacteria included the quantity of peptidoglycan in the bacteria cell wall. Ggram-positive strains included further peptidoglycans in their cell walls, compared to those Gram-negative strains did, allowing AgNPs to include extended inhibition zones for these strains.

This study demonstrated effectiveness of AgNPs in extending food shelf life by inhibiting microbial growth. Studies, including those by Abbaszadegan et al. and Eslami et al., highlighted the nanoparticle efficacy against various bacteria, with Gram-positive strains such as S. aureus exhibiting a greater susceptibility, compared to that Gram-negative E. coli doing. This difference was attributed to the thicker peptidoglycan layer in Gram-positive bacterial cell walls, offering a larger target for AgNPs.

Researchers investigated the potential of AgNPs to combat microbes in various settings, including food preservation. In a study by Eslami et al. (2016), effectiveness of AgNPs in preserving saffron was investigated. Various concentrations of nanoparticles were incorporated into packaging materials and the microbial loads on the saffron were monitored over time.

 

Figure 5. Statistical findings of the minimum inhibitory concentration assay using ANOVA

 

Table 1. Estimated nanosilver concentrations for MBC, MIC and MFC

 

Table 2. Results of the inhibition zone assay for silver nanoparticles and nanocomposites

 

 

Results showed significant decreases in microbial growth, particularly at higher nanoparticle concentrations, highlighting the potential of this technology for extending the shelf life of food products [10]. Antibacterial activity of the AgNPs against hospital-acquired antibiotic-resistant strains of P. aeruginosa was assessed by Salomoni et al. [11]. Commercial nanoparticles effectively inhibited bacterial growth at specific concentrations, suggesting their potentials as tools to combat challenging infections. Further studies such as that by Alsharqi et al. deeper investigated mechanisms; by which, AgNPs exert their antimicrobial effects. Their in-vitro experiments demonstrated that nanoparticles interacted with bacterial cell membranes, ultimately suppressing bacterial growth. Significantly, this effect was observed against Gram-positive (S. aureus) and Gram-negative (E. coli) bacteria, although various degrees of susceptibility were observed [12]. Similar to the current findings, these studies collectively present encouraging evidence for the use of AgNPs as a novel antimicrobial strategy. Further studies are needed to assess their potential uses and safety profiles.

The SEM images of the treated bacteria cells revealed significant morphologic changes in the cell membranes after processing with AgNPs. Results indicated strong antibacterial reactivities in AgNPs that could inactivate harmful and pathogenic microorganisms [12]; similar to results of the present study.  Previous findings showed that AgNPs directly attacked the cell membrane of bacteria, causing significant morphological changes [12]. This verified strong antibacterial activities of these nanoparticles, further supporting their potentials to combat harmful microorganisms.

Yan et al. [13] investigated broadly mechanisms of action using proteomics approaches, revealing 59 proteins affected by silver interactions. Interestingly, silver interacted with several membrane proteins and triggered production of ROS within the bacteria. This ROS production ultimately damaged the cell membrane, leading to bacterial death. These findings were perfectly similar to findings from the current study and other studies, highlighting the potential antimicrobial roles of AgNPs. Additionally, Pooyamanesh et al. [14] successfully incorporated AgNPs into food packaging materials, demonstrating their effectiveness against various foodborne bacteria such as E. coli and S. aureus. This evidence strongly suggests that AgNPs include tremendous potentials in combating harmful bacteria, opening doors for novel uses in food preservation. However, further studies are necessary to fully understand their safety and optimize their effectiveness for various uses.

  1. Conclusion

This study has validated potentials of AgNPs and their nanocomposites for antimicrobial uses in food packaging. Findings from MIC, MBC and inhibition zone assays consistently have demonstrated their effectiveness against various bacteria, especially Gram-positive strains. These provide direct benefits for food preservation, extending shelf life while eliminating needs of harmful chemical additives. Integrating AgNPs into food packaging offers more than a chemical-free alternative; it presents a multifaceted solution with far-reaching benefits. First, it develops organic food production by effectively combating bacteria without conventional preservatives, fostering trust and enhancing food quality. Second, their significant antibacterial ability originates from their high surface areas and positive charges, disrupting the bacterial membranes and significantly extending food shelf lives. Third, the chemical resuscitation method allows for precise control of nanoparticle sizes, tailoring their interaction with specific bacteria for optimized performance. Fourth, the suggested solution blending method improves cost-effectiveness, making this innovative technology readily accessible. While further studies are critical to understand long-term effects and ensure responsible implementation, these diverse advantages offer AgNPs as a promising solution for the challenges of food preservation. While Gram-positive bacteria have demonstrated greater susceptibilities due to their cell wall structures, effectiveness of AgNPs even at authorized low concentrations and their minimal risks of release into foods further highlight their potentials as safe sustainable alternatives to the available antimicrobial agents. This study pioneers further investigations and optimization of silver nanoparticle-based food packaging solutions, offering a promising path towards enhanced food safety and decreased environmental adverse effects. However, it is important to acknowledge needs of continuous studies to comprehensively understand potential long-term effects of the current technology.

  1. Acknowledgements

Special thanks to the Nano Research Laboratory (Ultrasonic Section), Science and Research Branch of Islamic Azad University.

  1. Conflict of Interest

The authors declare no conflict of interest.

References

  1. Bruna T, Maldonado-Bravo F, Jara P, Caro N. Silver nanoparticles and their antibacterial applications. Int J Mol Sci. 2021; 22(13): 7202

https://doi.org/10.3390/ijms22137202

  1. Rashidi L, Khosravi-Darani K. the applications of nanotechnology in food industry. Critic Rev Food Sci Nutr. 2011; 51(8); 723-730.

https://doi.org/10.1080/10408391003785417

  1. Khosravi-Darani K, Bucci DZ. Application of poly (hydroxyalkanoate) in food packaging: Improvements by nanotechnology. Chem Biochem Eng Quart. 2015; 29 (2): 275-285

https://doi.org/10.15255/CABEQ.2014.2260

  1. Khoshbouy Lahidjani L, Ahari H, Sharifan A. Influence of curcumin‐loaded nanoemulsion fabricated through emulsion phase inversion on the shelf life of Oncorhynchus mykiss stored at 4 C. J Food Process Preserv. 2020; 44(8): p: e14592.

https://doi.org/10.1111/jfpp.14592

  1. Deus D, Kehrenberg C, Schaudien D, Klein G, Krischek C. Effect of a nano-silver coating on the quality of fresh turkey meat during storage after modified atmosphere or vacuum packaging. Poult Sci. 2017; 96(2): 449-457.

https://doi.org/10.3382/ps/pew308

  1. Liao S, Zhang Y, Pan X, Zhu F, Jiang C, Liu Q, Cheng Z, Dai G, Wu G, Wang L, Chen L. Antibacterial activity and mechanism of silver nanoparticles against multidrug-resistant Pseudomonas aeruginosa. Int J Nanomedicine. 2019; 14: 1469-1487.

https://doi.org/10.2147/IJN.S191340

  1. Jo Y, Garcia CV, Ko S, Lee W, Shin GH, Choi JC, Park SJ, Kim JT. Characterization and antibacterial properties of nanosilver-applied polyethylene and polypropylene composite films for food packaging applications. Food Biosci. 2018; 23: 83-90.

https://doi.org/10.1016/j.fbio.2018.03.008

  1. Mathew S, Snigdha S, Mathew J, Radhakrishnan E. Biodegradable and active nanocomposite pouches reinforced with silver nanoparticles for improved packaging of chicken sausages. Food Packag Shelf Life. 2019; 19: 155-166.

https://doi.org/10.1016/j.fpsl.2018.12.009

  1. Verma P, Maheshwari SK. Preparation of sliver and selenium nanoparticles and its characterization by dynamic light scattering and scanning electron microscopy. J Microsc Ultrastruct. 2018. 6(4): 182.

https://doi.org/10.4103/JMAU.JMAU_3_18

  1. Eslami M, Bayat M, Nejad ASM, Sabokbar A, Anvar AA. Effect of polymer/nanosilver composite packaging on long-term microbiological status of Iranian saffron (Crocus sativus L.). Saudi J Biol Sci. 2016; 23(3): 341-347.

https://doi.org/10.1016/j.sjbs.2015.07.004

  1. Salomoni R, Leo P, Montemor A, Rinaldi B, Rodrigues M. Antibacterial effect of silver nanoparticles in Pseudomonas aeruginosa. Nanotechnol Sci Appl. 2017: 115-121.

https://doi.org/10.2147/NSA.S133415

  1. Al-Sharqi A, Apun K, Vincent M, Kanakaraju K, Bilung LM. Enhancement of the antibacterial efficiency of silver nanoparticles against gram-positive and gram-negative bacteria using blue laser light. Int J Photoenergy. 2019; 2019; 2528490.

https://doi.org/10.1155/2019/2528490

  1. Yan X, He B, Liu L, Qu G, Shi J, Hu L, Jiang G. Antibacterial mechanism of silver nanoparticles in Pseudomonas aeruginosa: Proteomics approach. Metallomics. 2018; 10(4): 557-564.

https://doi.org/10.1039/c7mt00328e

  1. Pooyamanesh M, Ahari H, Anvar AA, Karim G. Synthesis and characterization of silver nanocompo-site as a food packaging. J Food Biosci Technol. 2019; 9(2): 73-82

https://journals.srbiau.ac.ir/article_14382.html



 

 

Investigating Untapped Potentials: Velvet Beans as Novel Prebiotic Sources and Their Effects on Gut Microbiota and Short-Chain Fatty Acid Level

Amalia Eka Puspita, Artini Pangastuti, Shanti Listyawati, Siti Lusi Arum Sari

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e17
https://doi.org/10.22037/afb.v11i1.44643

 

Abstract

 

Background and Objective: Prebiotics are non-digestible carbohydrates that selectively facilitate growth of beneficial microorganisms in the gut. Legumes naturally contain carbohydrates with potentials as prebiotic sources. However, numerous legume species remain uninvestigated in this context. The aim of this study was to identify such uninvestigated legumes as potential sources of prebiotics.

Material and Methods: Nine legume samples collected from Central Java and East Java, Indonesia, were extracted using maceration method. Digestion with HCl buffer and α-amylase followed by analysis with dinitrosalicylic acid and phenol-sulfuric acid methods assessed quantities of non-digestible carbohydrates. Three legumes with the highest non-digestible carbohydrates levels were assessed in vitro to investigate their abilities to promote the probiotics growth. Then, the most promising extract was assessed on mice to assess its effects on short-chain fatty acid levels using GC-2010 Plus and gut microbiota composition using metagenomic 16S rRNA markers.

Results and Conclusion: From the nine legumes assessed, bambara groundnut (23,51 mg.g-1), velvet beans (22.36 mg.g-1) and chickpeas (12.1 mg.g-1) included the highest non-digestible carbohydrates levels. Velvet beans showed a greater ability to stimulate growth of Lactobacillus plantarum and Bifidobacterium bifidum, compared to bambara groundnut and chickpeas. Administration of velvet beans to mice increased short-chain fatty acid levels in forms of acetate (12.6 mM) and propionate (3.28 mM). Significantly, velvet beans could modify composition of the gut bacteria by increasing diversity, decreasing dominance levels, increasing abundance of Bacteroides, Helicobacter, Mucispirillum, Bifidobacterium and Lawsonia genera and decreasing abundance of Lachnospiraceae NK4A136 group, Blautia and Lachnoclostridium species.

Conflict of interest: The authors declare no conflict of interest.

  1. Introduction

 

Prebiotics consist of non-digestible carbohydrates (NDCs) and are resistant to stomach acid and digestive enzymes; therefore, they selectively promote growth of beneficial bacteria in the large intestine [1,2]This fermentation process by gut bacteria produces short-chain fatty acids (SCFAs) such as acetate, propionate and butyrate, which can lower pH of the gastrointestinal tract (GIT) and affect gut microbiota compositions [3]. Decreases in pH can decrease number of pathogenic microorganisms and increase growth of beneficial microorganisms, which is linked to the tolerance of the latter microorganisms to acidic conditions. Previous studies have shown that specific prebiotics such as inulin can promote growth of beneficial gut bacteria such as Lactobacillus and Bifidobacterium. [4,5]. Similar effects were observed with fructo-oligosaccharides, increasing Bifidobacterium while decreasing harmful bacteria [6].

Legumes are renowned for their nutritional values, particularly as protein sources. However, they contain NDCs in the form of oligosaccharides and polysaccharides, which include potentials as prebiotics [7]. These components pass through the small intestine undigested and reach the large intestine, where they can promote growth of beneficial gut bacteria [8]. Studies have demonstrated prebiotic effects of common legumes such as cowpeas and black beans, including decreased pH levels, increased growth of Bifidobacterium and Lactobacillus and increased SCFA levels [9,10] however, a vast majority of legume species are grouped under the minor category, remaining virtually uninvestigated. Much legumes are consumed only by local communities in Java, Indonesia. Additionally, food industries ignore legumes due to a limited knowledge of their compositions and potential benefits. Investigating prebiotic potentials of the minor legumes presents a compelling opportunity to enhance their economic values.

No reports have been published on the prebiotic potentials of specific minor legume varieties used in the current study. While most studies on prebiotics have focused on familiar major legumes, the current study investigated the lesser-known varieties. Significantly, one minor legume, Mucuna pruriens (velvet bean), has shown promises to combat obesity in mice, but its prebiotic potentials must be investigated [11]. In the current study, minor legume samples were selected based on their NDCs content and ability to promote growth of common gut bacteria of Bifidobacterium bifidum and Lactobacillus plantarum [12,13]. Legumes with the most promising prebiotic potentials were further assessed in mice to assess their effects on SCFA levels and gut microbiota compositions. This study targeted caecum, the major fermentation site in mice (pH 4.4-4.6), and used metagenomic analysis of 16S rRNA gene sequences to characterize the microbial communities. The aim of this study was to investigate novel potential prebiotic sources from several assessed legume candidates.

  1. Materials and Methods

2.1. Selection of Legumes

A total of nine types of legumes that were not investigated as prebiotics were species grown and consumed by local people in Java, Indonesia. The minor legumes, including velvet beans (M. pruriens), bambara groundnut (Vigna subterranea), chickpea (Phaseolus vulgaris), calopo beans (Calopogonium mucunoides), snow pea (Pisum sativum var. saccharatum), winged beans (Psophocarpus tetragonolobus), sword beans (Canavalia ensiformis), red beans or senerek beans (P. vulgaris) and turi beans (Sesbania grandiflora).

2.2 Extraction of Carbohydrates

The prebiotic components in the legume samples were extracted using maceration method. Ethanol, a polar solvent known for its attraction to polar carbohydrates, was chosen as the extraction solvent. Then, 70% ethanol (v v-1) was used for maceration with a 1:10 sample:solvent ratio [14,15]. The mixture was set for 4 d and then filtered and the solvent was evaporated at 60 °C using rotary evaporator.

 

 

2.3. Assessment of non-digestible carbohydrate contents

Carbohydrate resistance of nine minor legume extracts was assessed using simulated stomach acid and digestive enzymes. Each extract was prepared as a 10% stock solution (w v-1) in distilled water (DW). Resistance was assessed using acidic and enzymatic digestions. Acidic digestion involved incubating 200 µl of 1% extract solution (v v-1) with 200 µl of HCl buffer (pH 1) at 37 °C for 4 h (16). The reaction was stopped with 1 N NaOH. Enzymatic digestion was followed by further incubation of 200 µl of acid-digested solutions with 200 µl of α-amylase enzyme (2 U.ml-1) in sodium phosphate buffer at 37 °C for 6 h. Heating at 80 °C for 10 min stopped the reaction. Each digestion was carried out in triplicate [15].

   The NDCs content was assessed using dinitrosalicylic acid (DNS) method for reducing sugars before digestion and the phenol sulfuric acid method for total sugars after acid-enzymatic digestion. Acid and enzyme analyses were carried out respectively to simulate digestion in the stomach and small intestine. The DNS method involved preparation of a reagent by dissolving 10 g of 3,5-dinitrosalicylic acid, 2 g of phenol, 0.5 g of sodium sulfite and 10 g of sodium hydroxide in 1 l of DW. Assay involved adding 100 µl of 1% legume extract solution (v v-1) and 100 µl of DNS reagent, followed by vortexing for 30 s, heating at 95 ℃ for 10 min (until color change), adding 33 µl of 40% sodium potassium tartrate
(w v-1) and diluting 10× with DW. Absorbance was measured at 540 nm using ELISA reader [17] For the phenol sulfuric acid method, 50 µl of digested solution were mixed with 50 µl of phenol solution and vortexed for 30 s; followed by mixing with 250 µl of H2SO4 (sample:phenol:H2SO4 ratio of 1:1:5), vortexing for 30 s, diluting 10× with DW and measuring the absorbance at 490 nm using ELISA reader (18). The NDC content in the extracts was calculated using Eq. 1 (15):

 

                                                   Eq.1

2.4. Probiotics Growth Stimulation

This study used the probiotic B. bifidum and L. plantarum. Bacterial growth was estimated using standard growth curve based on optical density at 600 nm and colony counts (CFU.ml-1)19. Bifidobacterium bifidum was incubated anaerobically at 37 °C, while L. plantarum was incubated aerobically at 37 °C using shaker incubators. The two bacteria were first propagated on MRS agar media for 24 h at 37 °C before inoculation into MRS broth media. After 24 h, inoculum was used to count cells and colonies. The OD 600 measurement at each dilution (100-10-10) estimated the number of cells. Colony counts for dilutions of 10-7, 10-8 and 10-9 were carried out using total plate count (TPC) method with triplicate plating.

Bifidobacterium bifidum and L. plantarum were propa-gated in each modified MRS broth growth medium. The MRS broth was prepared using 10 g of peptone, 4 g of yeast extract, 8 g of meat extract, 20 g of carbon sources (glucose, inulin and three types of legume extracts with the highest NDCs), 1 g of Tween 80, 2 g of potassium phosphate dibasic (K2HPO4), 5 g sodium acetate (CH3COONa.3H2O), 2 g of tri-ammonium citrate (C6H17N3O7), 0,2 g magnesium sulfate (MgSO4·7H2O) and 0,04 g manganese (II) sulfate (MnSO4·H2O), which were dissolved in DW up to 1 l [20]. The OD 600 was measured at 0, 24 and 48 h using ELISA reader. Then, number of the bacterial colonies was estimated from the standard curve.

2.5. Experiments on Animal Models

Promising prebiotic function legumes, based on their NDC levels and probiotic-stimulating abilities, were assessed in mice to investigate their effects on SCFA levels and gut microbiota compositions. Fifteen mice were equally divided into three groups of a negative control group fed with a standard diet, a positive control group fed with a standard diet supplemented with 5% inulin (w w-1) and a treatment group fed with a standard diet supplemented with 5% of the selected legume extract (w w-1). Each mice was housed individually, fed at 5 g per min rate with ad libitum water. Body weight and food intake of each mice were assessed daily for 28 d. After 28 d, mice were euthanized and their cecum were collected for further analysis.

2.6. Assessment of Short-Chain Fatty Acid Levels

   Analysis of SCFA levels in caecum contents was carried out using gas chromatography (Shimadzu GC-2010 Plus, Japan). First, 0.15 g of the sample was mixed with 1 ml of DW and centrifuged at 1008 × g for 10 min. Then, supernatant was analyzed using GC-202 Plus, Japan, provided by the Food and Agricultural Product Technology Testing Laboratory, Faculty of Agricultural Technology, UGM, Indonesia [21].

2.7. Metagenomic Analysis

   Genomic DNA was extracted from the caecum using ZymoBIOMICS DNA mini kit, following the manufacturer’s instructions. The extracted DNA concentration was assessed using BioPhotometer Plus (Eppendorf, Germany). Poly-merase chain reaction (PCR) amplified the V3 and V4 regions of the 16S rRNA gene using primers of 341F (CCTACGGGRGGCAGCAG) and 806R (GGACTACC-AGGGTTTCTA) [22]. Then, DNA sequencing was carried out using next-generation sequencing (NGS) method and MGISeq platform. All PCR and NGS studies were carried out at PT. Genetic Sciences Jakarta, Indonesia.

2.8. Data Analysis

Data were analyzed using SPSS software v.24.0 and one-way ANOVA with a significance level of α = 0.05. For significant differences, Duncan's multiple range test (DMRT) was used for post-hoc analysis. FASTA-formatted sequence data were analyzed with UPARSE v7.0.1001 to group sequences into OTUs (operational taxonomic units). Sequences with ≥97% similarity were assigned to the same OTU. Taxonomic profiling was carried out using QIIME v.1.7.0 and SILVA database. Multiple sequence alignment was carried out using MUSCLE v.3.8.31. Then, OTUs with abundance less than 0.005% were removed. Normalized OTU abundance was used to assess alpha and beta diversities. Alpha diversity analysis was carried out using QIIME v.1.7.0 and visualized using R v.2.15.3. This captured the within-habitat bacterial diversity, including the number of OTUs, Shannon-Wiener diversity index and Simpson index. Beta diversity, reflecting bacterial diversity between the habitats, was estimated using PCoA-based index calculated using FactoMineR, ggplot2 and R v.2.15.3.

  1. Results and Discussion

3.1. Quantity of Non-digestible Carbohydrates in Legumes

To qualify a compound as a prebiotic agent, its carbohydrates must resist digestion in the stomach and small intestine. Table 1 shows that velvet beans and bambara groundnut included significantly higher quantities of NDC, compared to other beans (p<0.05). Chickpeas demonstrated a relatively high quantities of NDC, compared to other legumes. In addition to the high quantity of NDCs, the low hydrolysis proportions of velvet beans (4.57%), bambara groundnut (8%) and chickpea (24%) indicated that most of the carbohydrates in these three beans were resistant to acid and enzyme digestions.

These results suggested that these three beans could reach the large intestine for selective fermentation by the beneficial bacteria. Based on the results, these three beans were further assessed in vitro to assess their abilities to stimulate beneficial bacteria.

Velvet beans (M. pruriens) are beans with high carbohydrates contents. Previous studies reported that raw velvet bean seeds contained up to 49.22% of carbohydrates [23] Total dietary fiber content of the velvet beans is known to reach 86.6 mg.g-1, which is higher than that of Canavalia gladiata and Vigna unguiculata [24]. Bambara groundnuts (V. subterranean) are known as food sources with high carbohydrate contents, reaching up to 64.4%. Previous studies have shown that most of the carbohydrates contained in bambara groundnut are dominated by oligosaccharides and polysaccharides [25]. Chickpeas (P. vulgaris) are known as sources of carbohydrates that consist of starch, fibers and oligosaccharides. Previous studies have reported that the total polysaccharide contents in chickpeas reach to 300-370 mg.g-1, while the indigestible carbohydrate contents in form of oligosaccharides reach to 41.8-85.3 mg.g-1 [26].

3.2. Propagation of Probiotics on Various Carbon Sources

The NDCs are qualified as prebiotics if they selectively encourage propagation of beneficial bacteria in the large intestine. This study investigated several prebiotic candidates known for their acid and enzymatic resistances, based on their high quantity of NDCs. The candidates included velvet beans, bambara groundnuts and chickpeas. The study assessed their abilities to stimulate propagation of the representative probiotics of B. bifidum and L. plantarum, commonly detected in GIT of humans and rodents [27,13]. Bacteria were cultured in MRS broth media with various carbon sources. Each medium contained 2% extracts (w v-1) of velvet beans (MRS-VB), bambara groundnuts (MRS-BR) and chickpeas (MRS-CP). Propagation of B. bifidum and L. plantarum on these sources was compared with those on cultures using 2% of prebiotic inulin (w v-1) (MRS-INU), 2% of glucose (w.v-1) (MRS+) and no carbon sources (MRS-). Figure 1a,b showed that the growth of B. bifidum and L. plantarum in MRS- media did not show significant increases after incubation for 48 h. Carbon source in the media is a substrate that is utilized by bacteria to form amino acids and other cell components, making it important for the multiplication of bacterial cells [28].

Figure 1a reveals diverse growth patterns for B. bifidum in various MRS media. Significantly, MRS-VB and MRS-CP media stimulated B. bifidum propagation after 24 h, compared to MRS-BR. However, the number of B. bifidum colonies in MRS-VB and MRS-CP media was lower than that in MRS-INU at 24 h (p<0.05). At 48 h, B. bifidum in media with the prebiotic candidate (MRS-VB, MRS-BR and MRS-CP) included a lower number than that it did in MRS+ and MRS-INU media (p<0.05). These results indicated that the three prebiotic candidates were not able to stimulate propagation of B. bifidum as well as inulin prebiotics. However, B. bifidum in MRS+ media included a better propagation rate, compared to that in MRS-INU. Despite its positive effects, glucose failed to control harmful bacteria such as Escherichia coli and Salmonella spp. This suggests that specific media and prebiotics might be needed to support particular beneficial bacteria while limiting harmful ones [29].

Figure 1b reveals that L. plantarum in MRS-VB, MRS-BR and MRS-CP media included a lower number of colonies at 24 h than that it did MRS-INU (p<0.05). At 48 h, L. plantarum in MRS-VB media included the highest number of colonies, compared to that it did in MRS-VB, MRS-CP and MRS-INU media. A carbon source of 2% velvet bean extract could stimulate propagation of L. plantarum to reach to 99.83 ±1.45 × 107 CFU.ml-1, which was significantly higher than inulin prebiotics and the other two prebiotic candidates (p<0.05). These results indicated that velvet beans included a better ability to stimulate L. plantarum during 48 h of incubation, compared to that inulin prebiotics did.

Proliferative Index was reported from log cell number at 48 h minus log cell number at 0 h. Table 2 shows proliferative index of the probiotic bacteria during 48 h of incubation in media containing various prebiotic carbon sources. Significantly, B. bifidum in MRS-VB media included a higher proliferative index and was significantly different, compared to that it did in MRS-BR and MRS-CP (p<0.05). However, the proliferative index of B. bifidum in MRS-VB media included a lower value, compared to that it did in MRS-INU and MRS+ (p<0.05). These results indicated that B. bifidum utilized inulin and glucose better than that the prebiotics in velvet beans did. These results were similar to previous results, which stated that propagation of B. bifidum could only be stimulated by inulin [30]. This was because B. bifidum could not utilize oligosaccharides such as fructooligosaccharides (FOS) and galactooligosaccharides (GOS) in legumes. Previous studies have reported that FOS-type prebiotics could stimulate propagation of all Bifidobacterium spp., except B. bifidum [30]. This was because B. bifidum did not include genes encoding β-fructofuranosidase enzyme, functioning to hydrolyze FOS [31].

   The proliferative index of L. plantarum (Table 2) in MRS-VB media showed the highest value, compared to that the other groups did (p<0.05). These results indicated that L. plantarum could better utilize carbohydrates in velvet beans better, compared to that inulin prebiotics and the other two prebiotic candidates did. Velvet beans (M. pruriens) are known to contain FOS prebiotics, which consist of glucose and fructose units linked by β(2-1) glycosidic bonds [32,33]. Previous studies have shown that L. plantarum can utilize FOS as a selective carbon source because it includes β-fructofuranosidase enzyme, which plays roles in FOS degradation [34,33]. Nucleotide sequence of the L. plantarum genome has demonstrated presence of the sacA gene, which expresses an enzyme that can hydrolyze FOS internally. Unlike extracellular enzymes in L. pentosus and L. paracasei, intracellular enzymes in L. plantarum can maximally utilize FOS prebiotics because there are no hydrolysis products that are consumed by other bacterial species in the large intestine. This reveals that L. plantarum utilizes FOS to compete with other microorganisms in the large intestine. Fermentation of FOS by L. plantarum produces secondary metabolites that inhibit propagation of pathogenic bacteria such as E. coli that produce β-glucuronidase enzyme [34].

3.3. Assessment of the prebiotic effects with prebiotic index

A prebiotic index value greater than 1 (>1) shows that a carbohydrate includes positive effects on propagation of the probiotic bacteria. Figure 2 shows that the prebiotic index of velvet beans and inulin in L. plantarum culture includes values greater than 1 (>1). Velvet beans included the highest value, compared to that inulin and other prebiotic candidates did (p<0.05). In B. bifidum culture, the three legume candidates included a lower proliferative index, compared to that inulin prebiotics did (p<0.05). These results demonstrated that prebiotics in velvet beans included good abilities to stimulate L. plantarum, compared to that the inulin did. Moreover, propagation of B. bifidum could only be stimulated by the inulin prebiotics.

3.4. Experiments on Animal Models: Changes in Body Weight and Food Consumption

Identified as promising prebiotic candidates, velvet beans were assessed in vivo using mice models. Mice in all three groups included similar body weights at baseline (Day 0) (Table 3). On Day 7, all groups gained weight with the treatment group (13.3%) showed the highest increase (not statistically significant), compared to the negative (12,3%) and positive controls (12,67%). By Days 21 and 28, all groups gained weight steadily with no significant differences between them (Table 4). However, all groups consumed more than 78% of the provided foods, demonstrating that prebiotics reached digestive system of all mice. Although significantly indifferent, treatment and positive control groups included lower body weights than that the negative control group did. A relatively high feed consumption in the treatment group did not cause significant increases in body weight of the mice. Previous studies have reported that velvet beans include anti-obesity effects by decreasing body weight in obese groups [11].

3.5. Short-chain fatty acid levels in animal models

Anaerobic bacteria primarily produce SCFA such as acetic, propionic and butyric acids via fermenting NDCs [35]. Significantly, positive control and treatment groups demonstrated higher levels of these SCFAs, compared to the negative control (Table 5). Levels of acetic and propionic acid in the treatment group significantly higher than those in negative control group (p<0.05), but significantly lower than those in positive control group (p<0.05). Levels of butyric acid in treatment and negative control groups were significantly lower than those in positive control group (p<0.05). This suggests that velvet beans supported propagation of the bacteria that produced these SCFAs, potentially leading to shifts in gut microbiome metabolism and SCFA production with benefits to gut health.

 Previous studies have reported that feeding germinated velvet beans can increase SCFA production in the cecum of broilers [36].

3.6. Diversity of the Gut Microbiota in Mice

   Structure of the microbiota community in each group was assessed using various alpha diversity indices (Table 5). Figure 3 shows a flattened rarefaction curve indicating that all OTUs in the three groups were detected.

Based on Table 5, Shannon index in the treatment group with velvet bean supplementation showed a lower value compared to the negative control (standard diet), but higher compared to the positive control (inulin supplementation). The Shannon index (H') is positively correlated with the diversity and evenness of bacterial species in a bacterial community [37]. These results revealed that species diversity and evenness in the treatment group were higher than the positive control but lower than the negative control. This was similar to the higher number of OTUs (species richness) in the treatment group compared to the positive control, but lower compared to the negative control. In addition to Shannon index, Simpson index was used as an indicator to estimate the diversity of gut microbiota in mice. A high Simpson index value demonstrates that the diversity of bacteria in a community is low. Furthermore, a higher Simpson index value indicates greater dominance of a particular bacterial species in the community [38]. Based on Table 5, it was detected that the Simpson index in the treatment group included a lower value, compared to the positive and negative control groups. These results showed that species diversity in the treatment group was higher than that in the controls. Moreover, a low Simpson index in the treatment group demonstrated a low dominance level, hence, it could be assumed that no community balances existed in the mouse gut bacteria. Bacterial community balance can create a positive ecosystem that includes good resistances to pathogens and improves digestive track health of the host [38].

Diversity between the groups (beta diversity) was analyzed using principal coordinates analysis (PCoA). Figure 4 shows the PCoA analysis, revealing distinct variations in the bacterial communities within the groups. Distances between the points that represent positive control and treatment groups on the PCoA plot show a closer proximity, indicating that the bacterial composition of these two groups included a greater similarity, compared to the negative control group. This verified that the bacterial communities in positive control and treatment groups were more similar to each other than the negative control.

3.7. Abundance and Composition of the Gut Microbiota in Mice

  Metagenomic analysis of the bacterial communities in mice cecal samples (Figures 5A) revealed that the Firmicutes and Bacteroidetes phyla included the highest relative abundance in all three groups. This finding is similar to that of previous studies, which showed that Firmicutes and Bacteroidetes were the dominant phyla in the gut of healthy individuals [41]. Abundance of Firmicutes in the treatment group (45%) was relatively lower than that in the positive (64%) and negative (62%) control groups. However, abundance of Bacteroidetes did not show significant differences between the three groups (20,23 and 21%). The Firmicutes/Bacteroidetes (F/B) ratio indicates homeostasis of the GIT. Increases or decreases in the F/B ratio reveal dysbiosis, which is associated to metabolic and inflammatory disorders. Increased F/B ratios are associated to obesity, which is characterized by increased abundances of the Firmicutes phylum [42]. Previous studies have reported that obese individuals received high-fiber diets for 1 y had decreased Firmicutes abundances [43]. Similar studies have reported that African children who consumed high-fiber diets had lower Firmicutes abundances than that children who consumed fast food [44] The current study revealed that the F/B ratio in the treatment group was lower than that in positive and negative control groups. This suggests that a 5% supplementation of velvet bean extract includes anti-obesity characteristics in mice. In addition to the dominant phyla, treatment group demonstrated enrichments in Proteobacteria (2%) and Actinobacteria (0.8%), compared to the control groups (respectively 0.8-4 and 0.5-1%).

 Significantly, Desulfobacterota, Deferribacterota and Campylobacerota showed significant enrichments in the treatment group (14, 12, 8%), compared to controls (respectively 4-7, 3, 2-5%).These findings highlight potential shifts in gut microbial composition following the interventions.

Figure 5B reveals that Lachnospiraceae dominated gut microbiota in all groups. However, the treatment group (21%) showed significantly lower abundance of Lachnospiraceae, compared to positive control (39%) and negative control (40%). While genera within this family produce beneficial metabolites, the high abundance was linked to glucose metabolism disorders and inflammatory bowel disease (IBS) [45,46].

Interestingly, Helicobacteraceae (8%), Deferribacteraceae (12%) and Desulfovibrionaceae (14%) were significantly enriched in the treatment group, compared to positive and negative control groups (2-4 and 3-7%, respectively). Significantly, Lactobacillaceae (7–11%) was abundant within all groups (Figure 5C).

Figure 6C shows genera that belonged to the top 10 highest abundances in all three groups. The Lachnospiraceae NK4A136 group, Blautia and Lachnoclostridium were the most identified genera from the Lachnospiraceae family. The Lachnospiraceae NK4A136 group included a lower relative abundance in the treatment (3%) and positive control (2%) groups, compared to the negative control group (18%). The Lachnospiraceae NK4A136 group include anaerobic bacteria that could produce SCFAs through the fermentation of polysaccharides, making them beneficial bacteria. However, previous studies reported that the negative control group included higher abundance of Lachnospiraceae NK4A136 group, compared to the group fed prebiotic tape ketan diets. The study showed that the Lachnospiraceae NK4A136 group was more abundant in stressed mice and its abundance decreased after feeding with prebiotic tape ketan diets [47].

Blautia genus, belonging to the Lachnospiraceae family, exhibited a diminished relative prevalence in the treatment (6%) and negative control (5%) groups in contrast to the positive control group (12%). Blautia is addressed for its involvement in synthesis of SCFAs, particularly propionate and butyrate. Similarly, Lachnoclostridium genus demonstrated a comparatively decreased prevalence in the treatment (2%) and negative control (3%) groups, compared to the positive control group (11%). Lachnoclostridium is highlighted for its anti-inflammatory characteristics and production of butyrate (48, 49). The higher propionate and butyrate levels in the positive control group (Table 5) support the current findings, as these levels were significantly different from that of the treatment and negative control groups.

Based on Figure 6C, Helicobacter genus from Helicobacteraceae included a higher relative abundance in the treatment group (8%), compared to the positive (2%) and negative (5%) control groups. Several Helicobacter spp. were detected in the treatment group, including H. typhlonius, H. bilis, H. japonicus, H. apodemus, H. rodentium and H. ganmani. Although most Helicobacter spp. in the GIT are potential pathogens, studies have investigated interactionS of Helicobacter spp. with other microbiota members that create positive effects. Helicobacter in the mouse GIT can enhance resistance to infectious diseases caused by Citrobacter rodentium and prevent infection without adaptive immunity [50]. Previous studies reported that H. bilis colonization in the cecum could induce specific immune responses in form of immunoglobulin G (IgG) activation, which could protect mucosal layers from Mucispirillum schaedleri infections [51].

Mucispirillum, part of the Deferribacteraceae family, showed higher abundance in treatment group (12%), highlighting potential interactions with the velvet bean interventions, compared to the control groups (3%). Identified species from this genus included M. schaedleri, which is known to invade the cecal mucosal layers and cause intestinal inflammations [52]. In addition to its negative effects, Mucispirillum is known to interact with the mucus and create a positive environment for the bacterial propagation in GIT. Previous studies detected that M. schaedleri, which colonized the mucosal layers played positive roles in protecting the host's GIT by forming a mucus barrier against the pathogen infections [53]. The studies showed that mice infected with Salmonella typhimurium that were previously colonized with M. schaedleri experienced significant decreases in intestinal inflammation, compared to the controls. Generally, M. schaedleri is antagonistic to S. typhimurium and can therefore inhibit virulence factors, tissue invasion and inflammation [52].

   Bacteroides spp. in the treatment (8%) and negative control (12%) groups included higher abundances, compared to the positive control group (5%) (Figure 6C). Bacteroides spp. produce SCFAs that can be absorbed by the intestine and include positive effects on the hosts [53]. Studies have shown that Bacteroides spp. are low in abundance in people with diarrhea, indicating that high abundances of Bacteroides spp. are positively correlated with digestive health [54]. Identified species from the genus Bacteroides included B. uniformis, B. acidifaciens and B. vulgatus. Techniqually, B. uniformis has been identified as a potential therapeutic agent for obesity due to its demonstrated capacity to restrict weight gain and increase butyrate concentrations within the intestinal tract [55]. Detected broadly in high-fiber diets, commensal gut bacteria of B. acidifaciens offer multiple health benefits. These bacteria help prevent obesity and improve insulin sensitivity, potentially decreasing risks of type 2 diabetes mellitus [56]. Known for its enzyme production, B. vulgatus degrades complex polysaccharides into SCFAs, offering gut health benefits [57]. This versatile bacterium possesses the ability to fight against pathogenic infections associated with inflammatory bowel disease (IBD) [58]. . Additionally, B. vulgatus serves as an anti-obesity agent and helps hyperlipidemia treatment, expanding its health effects [59].

   The relative abundance of Lactobacillus was lower in the treatment group (3%), compared to the positive and negative control groups (5% each). Lactobacillus is a genus known as probiotic bacteria widely used in the production of functional foods. However, abundance of Lactobacillus spp. is relatively low in the GIT [60]. Although Lactobacillus spp. include positive roles in host health as studies have reported that Lactobacillus spp. with high abundance are detected in groups with digestive infection diseases, IBD, diarrhea and IBS [61]. A majority of species detected in the treatment and negative control groups were L. intestinalis, while the species detected in the positive control group were L. intestinalis and L. hominis. The L. intestinalis, recently recognized as a probiotic agent, offers protective and homeostatic benefits for GIT. Studies have shown that the microorganism modulates the immune system to combat colitis infections in mice [62]. In addition to Lactobacillus, Ligilactobacillus genus was detected to include a higher relative abundance in the treatment group (3%) than the positive control (1%). Species of the Ligilactobacillus genus that have been investigated as probiotics include L. salivarius [63]. However, this study was unable to identify Ligilactobacillus to the species level.

   The relative abundance of Bifidobacterium spp. in the treatment (0.2%) and positive control (0,3%) groups was higher than that in the negative control group (0.04%). Similar to the established prebiotic inulin, supplementing mice with velvet beans significantly increased the presence of Bifidobacterium spp. in their caecum. This genus largely includes probiotic species. Bifidobacterium genus detected in the positive control group was dominated by B. animalis, while the treatment group was dominated by B. pseudolongum. The B. animalis, a probiotic species, modulates gut microbiota composition for anti-obesity effects and protects GIT by enhancing intestinal barrier functions [64]. Studies have shown that the microorganism improves insulin sensitivity and restores blood glucose homeostasis in diabetic mice [65]. Furthermore, B. animalis produces beneficial organic acids such as acetic acid, linoleic acid and DHA [66]. Well-known for its anti-tumor characteristics, B. pseudolongum as a probiotic that combats non-alcoholic fatty liver disease (NAFLD) boosts intestinal barrier functions and restores healthy gut microbiota compositions [67,68].

  1. Conclusion

This study assessed several legumes with potentials of development as prebiotic sources or functional foods. Bambara groundnuts, velvet beans and chickpeas passed the initial selection due to their high quantities of NDCs as a prebiotic characteristic. Velvet beans showed a better ability to stimulate B. bifidum and L. plantarum probiotics that were assessed in vitro, compared to bambara groundnuts and chickpeas. Thus, these passed the second selection. The abundance of Lactobacillus spp. in the velvet bean group (3%) was lower than that in the two controls (5%). Presence of prebiotic characteristics in velvet beans was validated by the increased levels of SCFAs in the cecum of mice as a result of NDC fermentation. Supplementation of velvet beans in mice can alter gut microbiota compositions. This alteration involves balancing the bacterial community, which is positively correlated with enhanced host defense systems.

  1. Acknowledgements

This study was supported financially by Sebelas Maret University.

  1. Conflict of Interest

This study was supported financially by Sebelas Maret University.

  1. Authors Contributions

Conceptualization and design of the experiments, A.P and S.L.A.S; methodology, A.P and A.E.P; carry out of the experiments, A.E.P; analysis of data, A.E.P; contribution to reagents/materials/analysis tools, A.P; original draft preparation, A.E.P; review and edition, A.P. and S.L.

Background and Objective: Chocolate is a trendy food consumed by various age groups. It has been hypothesized that shocolate can become a significant functional product by incorporating probiotics into it. In this study, chocolate was used as a food matrix to transfer probiotic microorganisms to it. Bitter chocolate was chosen due to its preference by the consumers. Therefore, free and microencapsulated probiotic cultures were prepared.

Material and Methods: Lactiplantibacillus plantarum was used as the probiotic microorganism and calcium-alginate gel capsule was used for microencapsulation. The number of microorganisms and sensory characteristics of free, microencapsulated probiotic culture and culture-free bitter chocolates were assessed after 60 d of storage at 18 °C.

Results and Conclusion: Based on the results, count of the microorganisms in probiotic chocolate was 5.8×107 CFU g-1 on Day 0, while it decreased to 1.7×107 CFU g-1 on Day 60. Although decreases were seen in the level of probiotics, it has been shown that shocolates included sufficient counts of probiotics to be reported as probiotic chocolates. The microbial count of probiotics in microencapsulated probiotic chocolate (2.1×107 CFU g-1 on Day 0) decreased significantly to 2.4×105 CFU g-1 on Day 60. The highest microbial count was observed in samples containing free probiotic cultures after 60 d. However the microbial count did not decrease significantly in samples containing free cultures, 2-log decreases were observed in microencapsulated cultures. Thus, chocolate can be used as matrix for the probiotics. For sensory analysis, sample containing free culture was the most preferred after 60 days of storage regarding the overall acceptability.

Conflict of interest: The authors declare no conflict of interest

1. Introduction

Consumption of functional products, including probiotic foods, has increased worldwide. Pursuit of healthy eating and lifestyle has affected humanity in recent years, leading to health-conscious individuals to turn to functional foods. Probiotics, live microorganisms with positive health effects when consumed appropriately, are incorporated into foods, enhancing nutritional and technological characteris-tics of the foods. These functional probiotic foods promote intestinal health by increasing beneficial microorganisms, preventing diarrhea and inhibiting harmful pathogen colonization. Other benefits include lowering blood cholesterol, strengthening the immune system and neutr-alizing cancer-causing compounds. Addition of probiotics to foods is critical for the human health [1-4]. Lactiplanti-bacillus plantarum (L. plantarum) is a microorganism belonging to the probiotic microorganism group [5-7]. Addition of probiotic microorganisms to food products can lead to decreases in the number of probiotic cultures due to the stressful environments. To minimize these barriers, techniques such as the selection of bacterial strains, regulation of food processing processes and microencap-sulation have been developed and used to protect probiotic bacteria. Microencapsulation is the process of entrapping microorganisms with appropriate carrier support materials. This creates a film layer around the cells, protecting the cell viability against the barriers. The most studied technique in this method includes extrusion coating based on the forming calcium-alginate gel capsules [7].

Alginate is used in the microencapsulation method due to several advantages. These include being non-toxic to the body, having characteristics that easily encapsulate bacteria, being safe for foods, being inexpensive and being soluble in the intestines. Size and shape of the beads formed in the microencapsulation method depend on the diameter of the needle; through which, alginate is transferred, density of the alginate and distance; to which, the alginate is transferred [8-12]. Probiotic foods include approximately 60-70% of the functional food market. Although a majority of the probiotic products are yogurts and fermented dairy products, production of non-dairy probiotic products such as chocolates has increased in recent years [10,13]. Cocoa butter, sugar and cocoa particles include basic components of the chocolates. Researchers have reported that chocolate has characteristics that can carry probiotic microorganisms and tolerate adverse effects of the gastrointestinal system [14,15]. It has been reported that Bifidobacterium lactis, Lactobacillus (L.) acidophilus, L. paracasei, L. casei and L. rhamnosus probiotics have successfully been used in production of chocolate and cocoa desserts. Based on a similar study results, no difference was found in sensory characteristics and the products could be used as carrier matrices for the probiotics, comparing probiotic-added products with control samples [16].

The primary aim of the present study was to decrease digestive problems caused by the changes in the intestinal microbiota due to the changes in the current diet systems and frequent uses of fast ready-to-eat meals. Reactions can develop against the probiotic isolates, especially in childhood. The target includes development of intestinal microbiota by adding probiotic cultures to foods such as chocolates, which are loved by the people of all age groups. So, aim of this study was to add L. plantarum probiotics (microencapsulated and free) to bitter chocolate samples that provided them functional characteristics. A probiotic strain, which was a food supplement in capsule form, was used in the study. This was a novel approach for the chocolate matrix. In addition, temperature value assessed as the storage temperature in functional chocolate experiments was a temperature value that was not used previously. Changes in the number of microorganisms in chocolates turned into functional products at the end of the storage and their sensory characteristics were assessed by trained panelists. Another aim included assessment of the matrix characteristics of chocolates in carrying probiotic cultures.

2. Materials and Methods

Bitter chocolate was purchased from Solen Cikolata Gida Sanayi, Gaziantep, Türkiye. The probiotic microorganism used included L. plantarum 299v. This microorganism (later named L. plantarum) was isolated and used from a commercially available probiotic food supplement (Probest, Abdi Ibrahim Ilac Sanayi ve Ticaret Anonim Sirketi, Istanbul, Türkiye). McFarland Unit Cell Densitometer (Biosan SIA, Latvia) is used to measure cell concentrations. All the chemicals were purchased from Merck, Germany.

2.1. Chocolate

Chocolate production includes several stages. In the final stage, semi-finished chocolate is tempered, molded and packaged. In the tempering process, semi-finished chocolate is melted at 50 °C and then cooled down to 28 °C. This process is repeated 4-5 times. As a result of the process, chocolate is poured into molds. With the tempering process, chocolate becomes much smoother and shiny. Semi-finished chocolate was used in the current study and no tempering process was used to assess the matrix formation characteristics of chocolates for the probiotic microorgan-isms. Chocolate production was designed in three various ways. The first sample included normal chocolate without microbial culture, the second sample contained free-form probiotic microorganism culture (L. plantarum) and the third sample included microencapsulated probiotic L. plant-arum culture (Figure 1). In preparation of the chocolate, semi-finished chocolate was melted at 50 °C using water bath and then transferred to sterile molds [17]. Molded chocolate was cooled down at room temperature and set to harden. Chocolate was stored at 18 °C until analysis. Characteristics of bitter chocolate used as semi-finished product in the study are listed in Table 1.

2.2. Addition of Probiotic Microorganisms to Chocolates

In this study, L. plantarum probiotics were used. The L. plantarum was cultured in MRS media at 37°C for 24 h. To quickly assess the probiotic culture for the addition to chocolates, bacterial count was set to 1 McFarland (approximately 3.0×108 CFU ml-1). In assessment of the exact number of the bacteria, necessary dilutions were prepared and the number of microorganisms was assessed using spreading method. Probiotic and microencapsulated cultures were added to the chocolates and the chocolates were then transferred to sterile packages. The mixture was allowed to cool down at RT until the desired hardness was achieved. The chocolate packages were sealed and stored at 18 °C using incubator. Number of microorganisms was assessed on Days 0, 30 and 60 of storage and sensory analyses were carried out [18,19]. All studies were carried out in two parallels and three replications.

2.3. Microencapsulation of Probiotic Microorganisms

Extrusion technique was used for the microencaps-ulation of probiotic microorganisms. During preparation of the probiotic cultures, cultures were centrifuged at 3000 g after incubation in MRS media at 37 °C for 24 h). After discarding the supernatant, cultures were dissolved and concentration of the microorganisms increased using 1 McFarland (approximately 3.0×108 CFU m-l). Microorgan-isms were added into a previously prepared 1% sterile sodium alginate solution using syringe. The homogenized alginate with bacterial mixture was transferred to a 1% (w v-1) sterile CaCl2 solution [18]. The alginate with the bacterial mixture was homogenized in CaCl2 solution using magnetic stirrer and then solidified. Beads were filtered using Whatman no. 4 filter papers and transferred to sterile Petri dishes [20]. During chocolate production, microencap-sulated culture from these Petri dishes was homogeneously added to the chocolates [21].

2.4. Assessment of the Number of Probiotic Microorganisms

The L. plantarum probiotic was homogenized using sterile dilutions containing 0.85% (w v-1) salt and 0.1% (w v-1) peptone. Briefly, 1 ml of the homogenized sample was diluted with dilution fluid. Diluted samples were spread plated on de Man, Rogosa and Sharpe (MRS) agar and incubated at 37 °C for 48 h [22]. After incubation, number of the microorganisms was assessed. To assess number of the microencapsulated L. plantarum, sterile sodium citrate buffer was added to the sample and homogenized for 15 min using magnetic stirrer. Then, 1 ml of the homogenized chocolate was used to prepare sufficient dilutions [21]. Number of the microorganisms was assessed using sprea-ding method. After incubation at 37 °C for 48 h, number of the microorganisms was assessed. All studies were carried out in two parallels and three replications.

2.5. Sensory Analysis of Probiotic Chocolates

For sensory analysis, a panel of ten people was selected and trained. Samples were assessed for appearance (smoothness-appearance, brightness and blooming), aroma (cocoa flavor and off-flavor), taste (cocoa taste and sweetness), texture during the first bite (hardness and brittleness) and chewing (strength, smoothness-texture, melting level, stickiness, spread and mouth covering), color (brown color) and overall acceptability. Participants rated each characteristic on a scale of 1-9. Numbers representing the scale were established as 9, extremely like; 5, neither like nor dislike and 1, extremely dislike [17].

2.6. Statistical analysis of Probiotic Chocolates

Findings of this study were reported as means of triplicate data with standard deviations (SD). Analysis of data was carried out using ANOVA. Significant differences (p<0.05) in individual means were assessed using Tukey’s HSD test. The SPSS software v.22.0 (IBM, Chicago, USA) was used to analyze the results. Results were expressed as means ±SD.

3. Results and Discussion

In the study, number of the probiotic microorganisms in each chocolate (chocolate without probiotics, probiotic chocolate and microencapsulated chocolate) after storage was assessed and sensory characteristics of the chocolates were analyzed.

3.1. Microbiological Analysis

With the microbial analysis results, potential of the bitter chocolate as a matrix for L. plantarum was assessed. Results of the microbiological analysis are present in Table 2. Based on Table 2, it was assessed that chocolate without added probiotics did not contain microorganisms on Days 0, 30 and 90. Chocolate is generally not a product; in which, microorganisms can multiply. Moreover, it was assessed that the microorganism counts of chocolate with probiotics were 5.8×107 CFU g-1 on Day 0, 2.5×107 CFU g-1 on Day 30 and 1.7×107 CFU g-1 on Day 60. It was shown that number of the microorganisms did not change significantly (p<0.05) after storing probiotic chocolate for 60 d. It was concluded that chocolate could be used as a matrix for probiotics as the number of microorganisms was 1.7×107 CFU g-1 on Day 60. When free form of L. plantarum was added to chocolates, no significant changes (p<0.05) were observed in the number of microorganisms for 60 d. Although addition of high quantities of the culture was initially carried out to achieve a high culture count in the final products, high quantities of the free culture could adversely affect taste of the chocolate. For the probiotic microorganisms to include beneficial effects on human health, probiotics should be present in foods at a level of 106-107 CFU g-1(or ml-1) [23,24]. Regarding the results, it has been demonstrated that the measured free probiotic culture was included in these values with beneficial effects. Several studies support these results. A study reported bitter chocolate as an appropriate matrix for the transport of B. breve NCIM5671 strain [25]. Another study stated that the number of probiotic bacteria added to chocolates was constant [26].

Based on Table 1, 2.1×107 CFU g-1 microorganisms were inoculated into the chocolate in production of microen-capsulated chocolates. Number of the microorganisms was 6.0×105 CFU g-1 on Day 30 and 2.4×105 CFU g-1 on Day 60. Furthermore, number of the microorganisms decreased significantly (p<0.05) at the end of Day 30. Number of the microorganisms did not change significantly (p<0.05) within 30 and 60 d of storage. In a study by Erginkaya et al., [17], it was stated that bitter chocolates stored at 4 and 25 °C for 60 d showed differences in physical characteristics due to storage at various temperatures. It was also stated that a storage temperature of 25 °C caused significant decreases in the microbial count. In the present study, a storage temperature of 18 °C was set, which was within the temperature range in the highlighted study and the commercial storage temperature for chocolate. Studies showed that storage temperature caused decreases in microbial counts at 4 °C and probiotic cell concentration decreased by 1-2 log CFU g-1. At 25 °C, microbial counts decreased by 4-7 log CFU g-1 [14,18,27]. Based on the results, it was clear that chocolate could be used as a matrix to include probiotics. Several studies support this conclusion [14-17].

The global market for probiotic foods, supplements and probiotic foods is growing significantly. Therefore, cell encapsulation is emerging as an alternative for the incorpo-ration of probiotics into various food matrices. [28]. In the present study, alginate concentration used for the capsule formation was set at 1% (w v-1); thus, avoiding adverse effects on the appearance of chocolates. However, capsules formed within the gel concentrations did not sufficiently protect the probiotic cultures. In addition to the studies supporting these results, there are studies indicating that the microencapsulation process is an effective method for protecting probiotics. In a study, although starch-alginate capsules included the highest survival rate within the encapsulated cells, less than 1 log CFU g-1 of loss occurred [29,30].

In another study, probiotic strain of Limosilactobacillus reuteri DSM 17938 and non-probiotic strain of L. plantarum 48M were microencapsulated in alginate matrix using emulsion technique. Survival of microorganisms in microcapsules was assessed against gastric conditions and heat stress. Results showed that the microencapsulation process increased viability of L. plantarum 48M cells following exposure to gastric conditions, resulting in similar survival to L. reuteri DSM 17938. Additionally, it was stated that microencapsulation could not protect L. reuteri DSM 17938 and Lactiplantabacillus plantarum 48M cells when exposed to heat treatment [31]. There are studies indicating that microencapsulation is effective in protecting probiotics against adverse environmental conditions [5,6]. The fact that the microencapsulation process cannot protect microorganisms exposed to heat in the results shows that decreases in the number of microorganisms as a result of the microencapsulation process may be a normal result. Studies have demonstrated that chocolate can be used to transport probiotics without the need of microencapsulation process [18,32-35]. İn contrast, there are several studies indicating that the use of probiotics in foods via micro-encapsulation method is more effective than the use of free probiotics [11,13,23,30,36-40]. Chocolate enriched with encapsulated probiotics (probiotic-chocolate) and control (chocolate with non-encapsulated probiotics) were stored under aseptic conditions at 25 and 4 °C for 120 d. Relatively, when the protective effects of probiotic chocolates were compared, encapsulated chocolates includ-ed further probiotics (at least 2.0 log) after 120 d, compared to non-encapsulated probiotics. This verified that the encapsulates were protective under the two storage conditions [41]. Despite the encapsulation process, probiot-ics could be affected by stress conditions and the microencapsulation process could be affected by several parameters. These parameters were assessed as the size of microcapsules [29, 42], encapsulation method and coating materials as well as the concentration [9,18,24,28,37,40,43]. In production of capsules, encapsulation is based on alginate materials and addition of prebiotics to alginate increases protection of the capsules [28,29,40]. Studies have shown that the survival rates of probiotics depend on the type of probiotic, type of chocolate, storage temperature and time [18,32,43,44].

In a study by Sedefoglu et al. [7], ice cream samples were encapsulated with alginate to assess bacterial counts. They concluded that encapsulation did not provide additional protective effects to the probiotics. In cases; where the storage duration exceeded 120 d, microorganisms in microencapsulated samples were still viable. In a study, encapsulated L. plantarum 564 and commercial probiotic L. plantarum 299v were added in the production of bitter chocolates and it was seen that the probiotic bacteria survived very well after the production and during storage [45]. Although effects of alginate encapsulation on the survival of lactic acid bacteria in the food matrix has been studied, uniformity in the encapsulation procedure has not been identified in studies yet. Studies vary in capsule size, alginate concentration, calcium chloride concentration, hardening time of the capsules in calcium chloride and the initial number of the cultures, leading to differences in the survival of encapsulated bacteria. In summary, a higher number of microorganisms were detected in chocolates produced using free probiotic culture than in those with added probiotic cultures through microencapsulation. Additionally, it has been reported that chocolate can be used as a matrix to include probiotics.

3.2. Sensory Analysis Results

Sensory analysis results of the probiotic bitter chocolate samples during storage are provided in Tables 3 and 4. Description of the characteristics is as follows. Smoothness-appearance, smooth appearance of the product’s surface without lumps of grits; brightness, intensity of light reflection in the product, opposite of opaque; bloom, white-gray layer of the visible lipid/sugar crystals on the surface; cocoa aroma, aroma of the cocoa powder (from none to very); off-flavor, unpleasant and unwanted aroma in the product; cocoa taste, intensity of the taste of cocoa in the product; sweetness, taste quality most often associated with sucrose (none to very); hardness, force needed to cut the food using central incisor teeth; brittleness: breakage level of the piece of chocolate in first bite; strength, force needed to compress samples between tongue and palate; smoothness-texture, levels of even and consistent continuity of the product in mouth; melting level, time needed to melt half of the sample while chewing (slow to fast); stickiness, level of stickiness to molar teeth; spread, level of covering surface of the mouth; mouth covering, the after-feel film, which covers the mouth surface; brown color, light brown to dark brown; general acceptability, acceptability of the product in general with all of its sensory characteristics [7].

As seen in Table 3, no significant level (p<0.05) was detected in sensory characteristics of the chocolates without probiotics, probiotic chocolates or microencapsulated chocolates on Days 0 and 30. Sensory characteristics of the chocolate samples on Day 60 showed significant differences (p<0.05). From daily parameters, the highest smoothness value was assessed in the microencapsulated chocolate sample. This was due to the structure of the chocolate changing after a certain time. It was assessed that the brightness, blooming, cocoa flavor, off-flavor, cocoa taste [similar importance as probiotic chocolate (p<0.05)], hardness, stickiness and brown color parameters of the chocolates without probiotics were significant (p<0.05).

It was also stated that cocoa taste, sweetness, brittleness, strength, melting level, spread and brown color [similar importance as chocolate without probiotic (p<0.05)] were significant as well (p<0.05) in probiotic chocolates. In microencapsulated probiotic chocolate, smoothness-appearance, strength [similar importance as probiotic addition (p<0.05)], smoothness-texture and mouth covering characteristics were statistically significant (p<0.05). Various characteristics of chocolates were assessed through sensory analyses. On Day 60, it was reported that eight sensory parameters of the chocolates without probiotics, eight sensory parameters of the chocolates with probiotics and four sensory parameters of the microencapsulated probiotic chocolates were significant (p<0.05). It has been assessed that chocolates with probiotics were different significantly (p<0.05) from chocolate with microencapsul-ation and chocolate without probiotics addition in general acceptability. This is one of the important characteristics in sensory analyses. At the end of 60 d of storage, the most favored chocolate was that containing free culture, followed by the microencapsulated chocolate. Graphical represen-tation of the results is provided between Figures 2 and 3. Table 4 presents sensory analysis results of the probiotic bitter chocolate samples over the storage, based on the added cultures. Based on Table 4, sensory analysis results on Days 0, 30 and 60 were provided based on the added cultures. In chocolate samples without probiotics, the brittleness parameter included a significant level (p<0.05) on Day 0, whereas this characteristic decreased on Days 30 and 60. Regarding sensory parameters of the probiotic chocolate, hardness showed significant decreases (p<0.05) over time. In general acceptability parameter, the highest value was reached after 60 d. It was recorded that cocoa taste and hardness parameters of the chocolate containing microencapsulated probiotics decreased significantly on Day 60. Based on the general acceptability results, chocolate containing probiotics was acceptable at a significant level (p<0.05) depending on the 60-d storage. Studies indicate that the addition of probiotics to affect functional characteristics of the chocolates does not make changes in sensory characteristics [16,18,32-36,45]. In a study, sensory and physiological characteristics such as color, texture, rheology and melting profile of bitter chocolates with added probiotic cultures and control bitter chocolate samples without probiotics were compared. Results showed that physiological characteristics of the chocolate containing probiotics and control chocolate did not differ significantly [25].

Other studies reported that chocolates with microencap-sulated probiotics received similar scores in sensory evaluations, compared to those containing free probiotics [18,35]. In another study, it was assessed that microcapsules containing bitter chocolate included no differences with two commercially available chocolates based on the hedonic sensory assay [26]. Although it was stated that adding probiotics to chocolate varieties did not include negative effects based on the sensory assessment results; however, the study reported significant decreases in the general liking scores of all chocolate samples after 60 d of storage [18]. In another study, chocolates were investigated for aw, pH, surface color and morphology, hardness, microbiological quality, sensory acceptance and probiotic viability. After 120 d of storage at 25 °C, probiotic populations in chocolate decreased by a maximum of 1.4 log due to the stress environment. Based on these results and a good acceptance of all samples by the panelists, semisweet chocolate can be addressed as a good matrix for probiotics [33].

4. Conclusion

This study concludes that chocolate is an appropriate food for carrying probiotic cultures. Additionally, importance of chocolates containing probiotic cultures emerges due to their popularity within children and difficulty in supplementing children foods with probiotic cultures. By adding probiotic cultures to chocolates, functional foods can be prepared. The fact that chocolates containing free culture did not show decreases in the number of microorganisms indicates that cultures can be added without the microencapsulation process. No changes in sensory characteristics were observed after adding probiotic cultures to the chocolates and their general acceptability values were higher than those of other samples. High values were achieved in microbial and sensory analysis results by adding free probiotic cultures to the chocolates without microencapsulation. This eliminates needs of further labors, times and costs for the microencapsulation process. Thus, chocolates can be added with functional characteristics using added free probiotics. Several parameters were effective in low detection of probiotics as a result of the microencapsulation process. Microencapsulation method used in the present study included container material, CaCl2 volume and alginate section, where various microencapsulation blockers were stored. As a result of the study, it is concluded that chocolate can be used as a matrix in distribution and formation of probiotic cultures. The current study suggests further studies to carry out. These studies can involve various probiotics, adjusted storage temperatures and durations and modified parameters in microencapsulation processes

5. Acknowledgements

The author expresses his deepest gratitude to Kilis 7 Aralık University, BAP Unit, for its support provided under the current project of 21-13392.

6. Conflict of Interest

The author declares no conflict of interest.

Assessment of the Physicochemical, Antioxidant, in-vitro Anti-diabetic and Nutritional Characteristics of Pigeon Pea Protein Hydrolysates

Jyoti Mukherjee, Nagaveni Shivshetty, Venkata Giridhar Poosarla

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e19
https://doi.org/10.22037/afb.v11i1.44371

Background and Objective: Cajanus cajan (pigeon pea) seeds include special characteristics that can serve as alternative vegan protein sources. The aim of this study was to investigate bioactive peptides in the pigeon pea using economically feasible method of acid and enzymatic hydrolysis.

Material and Methods: In this study, pigeon pea was subjected to hydrolysis by two methods of acid and enzymatic hydrolysis. The generated hydrolysates were characterized by result analysis of the protein content and yield, degree of hydrolysis, anti-nutritional profile, Fourier transform infrared spectroscopy, antioxidant assay of 2,2-diphenyl-1-picryl hydrazyl, hydroxyl radical scavenging assay, metal chelating ion assay and reducing power. Moreover, antidiabetic effects were assessed using α-amylase inhibition assay.

Results and Conclusion: Pigeon pea was digested by acid (pH 4) and enzyme hydrolysis, further subjected to membrane filtration to achieve peptide fractions with bioactive characteristics. The hydrolyzed pigeon pea showed good increased protein contents and degree of hydrolysis, compared with the control. Degree of hydrolysis were 62.7% for acid, 68.42% for enzyme and 34.32% for unhydrolyzed proportion. Hydrolyzed samples included Fourier transform infrared  peaks at 3500–4000 cm-1, showing amides I and II. The resulting peptides after the hydrolysis showed a higher range in acid hydrolysis (250–20 kDa), whereas the EH fractions showed a very low molecular weight of less than 15 kDa. Peptides produced by AH demonstrated considerable bioactive characteristics, compared to EH antioxidant and anti-diabetic characteristics against the standards. This study highlights production of pigeon pea protein hydrolysates using two methods of traditional (acid) and modern (enzymatic), showing that acid hydrolysate can be a cheap economical method for generating protein hydrolysate with good bioactive characteristics.

 1. Introduction

Recently, high demand for plant proteins have been reported due to production of plant-based meat, shifting consumer preferences and increased awareness of their role in health and fitness. Legume seeds include a critical place in the human diet worldwide as a rich source of proteins. Legumes are classically called the poor man’s meat when animal proteins are limited or when poverty, spiritual or holy preferences prevent consumption of meat. One of the most essential dietary legumes is Cajanus cajan, commonly known as pigeon pea and red gram in English [1, 2]. Production statistics of pigeon pea reveal that India contributes to nearly 90% of the global production. Despite having a high nutritional profile, pigeon pea is underused and received little attention from research and development to unlock its potential uses in food industries. Cajanus cajan is a significant source of proteins, vitamins and minerals rich in essential amino acids (EAA), with large quantities of lysine, which is often a limiting factor in plant-based proteins within the dietary legumes playing critical roles in human nutrition. Numerous studies on pigeon pea have revealed significant findings such as antioxidant, anti-hypertensive, anti-diabetic, anti-carcinogenic, anti-coagulant, anti-inflammatory and certain satiety effects. It is the most appropriate alternative for individuals with allergies or sensitivities to other popular sources such as soy, dairy, or wheat. It offers a hypoallergenic option for incorporating proteins into various food systems. Pulse proteins are a rich source of potential bioactive sites with the help of hydrolysis, autolysis, gastrointestinal digestion and fermentation. Complex protein in pigeon pea when subjected to artificial hydrolysis, natural gastrointestinal digestion or fermentation hydrolysis forms peptides with good bioactive characteristics that can be used as functional foods, benefiting human health [1].

Multiple processes have been used for deriving protein hydrolysates, chemical and modified, of which, enzymatic protein hydrolysis is the most common process. Currently, most proteins are hydrolysed using proteolytic enzymes at the ideal temperature and pH. These often target particular peptide bonds, resulting in the release of AAs and peptides of various sizes [3]. In chemical methods, acid/alkaline hydrolysis are a conventional method. In chemical method, it is seen that mostly non-essential amino acids (asparagine, glutamine, cysteine, and tryptophan) are destroyed that are difficult to recover by acidic hydrolysis; hence, neutralization with a base (hydroxide) is recommended after heating. The hydrolysed protein is further subjected to membrane filtration or purification method [4]. The major problem of enzymatic hydrolysis is its expensive costs as well as presence of enzyme inhibitors in raw materials. The need of careful optimization and handling is essential, which can lead to enzyme denaturation or inactivation, resulting in incomplete hydrolysis with lower yields. An alternate economical method that can be used for protein hydrolysis includes acid hydrolysis. Studies have shown that essential amino acids (EAAs) such as aspartic acid, glutamic acid, proline, glycine, alanine, leucine, phenylalanine, histidine, and arginine can be achieved by acid hydrolysis (AH) [4]. Therefore, the aim of this study was to investigate the best cheap method for the production of pigeon pea protein hydrolysates via AH or enzymatic hydrolysis (EH) with good bioactive characteristics.

Bioactive peptides are addressed as nutraceuticals with health advantages associated with illness prevention or therapy. Studies on the antioxidant characteristics of crude protein hydrolysates have been carried out by several researchers [5–8]. Nutritional characteristics of pigeon pea have been associated with decrease in occurrence of various cancers, HDL cholesterol, type-2 diabetes, and heart diseases. These include compounds such as protease inhibitors, non-antinutritional components and angiotensin I-converting enzyme (ACE) inhibitor with possible beneficial characteristics [5,9,10]. Studies have shown that foods packed with antioxidants provide functional health benefits by acting as exogenous sources of antioxidants to neutralize oxidants. Recently, foods rich in protein-derived peptides, typically achieved through the hydrolysis of food proteins, have been assessed for potential therapeutic functions in preventing cellular damages from oxidative stress that promotes human health. These pulse proteins are the most investigated naturally occurring alternatives to synthetic antioxidants and antidiabetic characteristics. Pulse proteins have become popular due to their availability, accessibility, affordability and simpler derivative [11]. Furthermore, the novelty of this study is to highlight advantages, disadvantages and cost-effectiveness of various methods for producing superior bioactive peptides from pigeon pea. Research on the specific effects of AH on pulse hydrolysates is in its early stages, however presenting an exciting opportunity to tailor their functional characteristics.

2. Materials and Methods

Unpolished pigeon pea seeds were purchased from a local market in Karnataka, India. Olive oil was purchased from a local supermarket in Vishakhapatnam, India. All the chemicals and reagents were in analytical grade  from Sigma, Germany, Merck, Germany, and Himedia, India, and provided by a local vendor.

2.1. Preparation of the protein hydrolysate

Sample preparation was carried out based on a method described previously [12]. Seeds purchased were washed, sun-dried and powdered into fine meal using 40-mesh sieve. Roasted seeds were subjected to fat extraction process for nearly 6 h using an ethanol extraction-based system. Mixture was further subjected to distillation to achieve the final fat-free product for hydrolysis. For acid hydrolysis, hydrolysates were prepared using 6 M of HCl and were then added to defatted pigeon pea flour. Extracted samples were  with 6 M hydrochloric acid per mL for various time constraints under high pressure at 121 PSI for 3–4 h. Precipitated protein at isoelectric pH was removed from the suspension by centrifugation at 12298 g for nearly 20–30 min, adjusted to pH 7.0 with 0.1 M NaOH, lyophilized and stored at 4 °C [13]. For EH, pigeon pea sample was hydrolysed enzymatically using protease pigeon pea and fat-free suspensions were prepared using 100 g of the samples that was brought to a volume of 1 L with 0.10 M phosphate buffer (pH 7–7.4 under optimum conditions with the enzyme). The enzyme complex was added for each of the experiments at room temperature (RT), based on the enzyme/substrate (E/S) ratios (m/m) (0.1, 0.3, 0.5, 0.7, and 1). The reaction mixture was transferred into a bioreactor with a capacity of 20 L. Ranges used to assess variables of pH, temperature, and time included 1–9, 50–70 °C, and 100–180 min, respectively. Separation of the solid from the supernatant was carried out for each sample when the enzymatic activity ended via heating at 90 °C for 20 min. After decanting the samples, supernatant was centrifuged at 2490 g. Further selective filtration was carried out using 0.4-µm membrane filtration and the supernatant was freeze-dried and stored at 4 °C until further use [10,11,14].

2.2 Proximate composition of pigeon pea

Pigeon pea seeds (unhydrolysed, defatted, and hydrolysate) were analyzed for crude fiber, ash, and relative humidity using standardized methods by the Association of Official Analytical Chemists (AOAC) [15]. Crude fat was assessed using Soxhlet solvent extraction system [13]. Crude fat was calculated using the Eq. 1:

                                  Eq. 1

Where, W1 was the empty thimble, W2 was weight of the sample and thimble and P was weight of the sample.

2.3. Protein content assessment

Kjeldahl protocol was used as described previously [16]. Briefly, 200 mg of the samples were used in the analysis. Kjeldahl method was used to assess the protein content based on the protocol of AOAC IS 7219 [15]. The assessed nitrogen content was multiplied by 6.25 (the nitrogen-to-protein conversion factor for legumes) to achieve the final protein concentration of the samples [13] using Eq. 2:

                                                                                       Eq. 2

Where, a was the volume in 0.5 N acid assessed for distillation, b was the volume in 0.1 N base used for back titrating a, c was the volume in 0.5 N acid used for blank distillation a, and d was the volume in 0.1 N alkali used for back titrating c.

2.4. Degree of hydrolysis

The O-phthalaldehyde assay (OPA) procedure was used for assessing degree of hydrolysis (DH) as described by Nielsen [13]. The OPA was a sensitive technique widely used for pulse proteins [14] and DH was calculated using Eq. 3:

                                       Eq. 3

Where, V was the sample volume (0.1 lL), X was the sample weight (0.125 g), P was the soluble protein content (90%) of the sample and serine-NH2 was in meqv serine-NH2·g-1 protein (Eq. 4).

                                                             Eq. 4

Where, α and β were respectively the constants of 1.00 and 0.40 for the raw materials that were not assessed. The DH was calculated using Eq. 5

                                                      Eq. 5

Where, htot was the total number of peptide bonds per protein equivalent.

2.5. Protein yield assessment

The yield of protein pigeon pea samples (defatted, AH, and EH) was assessed as per modifications and was calculated using Eq. 6:

                                      Eq. 6

2.6. Assessment of anti-nutritional factors

Anti-nutritional factors of tannic acid, total phenol content, phytic acid, and trypsin inhibition were carried out as previously described [15].

2.6.1. Total phenolic content assessment

The total phenol content of various samples was assessed quantitatively using Folin-Ciocalteu method; in which, gallic acid was taken as standard and the absorbance was measured at 760 nm [15].

2.6.2. Tannins assessment

Presence of tannins was assessed using Folin-Denis reagent spectrophotometric method at 700 nm [15].

2.6.3. Phytic acid content assessment

Phytic acid content of the samples was assessed spectrophotometrically at 480 nm, where Fe (NO3)3 was used as standard [15].

2.6.4. Trypsin inhibition assessment

Trypsin inhibition activity was assessed indirectly by inhibiting activity of the synthetic substrate [Nα-benzoyl-D,L-arginine p-nitroanilife hydrochloride (BAPNA)], which was subjected to hydrolysis by trypsin to produce yellow colored p-nitroanilide at 400 nm [17].

2.6.5. Saponin assessment

Saponins were assessed spectrophotometrically at 430 nm using saponin (0–40 µg) as standard [17].

2.7. Fourier transform infrared spectroscopy

The Fourier transform infrared (FTIR) spectroscopy spectra of pigeon pea AH were recorded using ALPHA-II FTIR spectrometer (Bruker Optics, Germany) fitted with an ATR (attenuated total reflectance) sampling device containing diamond crystals. The absorbance spectra were 4000–400 cm-1 (with a standard KBr beam splitter) at a spectral resolution of 4 cm-1 with 16 scans co-added and averaged. Additionally, 1–2 g of the sample were finely powdered for the scan. Data were translated into transmittance units [18].

2.8. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) of unhydrolyzed and hydrolyzed samples was carried out using 5% stacking gel and 15% separating gel using Biobase gel system (Shandong, China) at 100 V. Gels were fixed in Coomassie brilliant blue (CBB) under RT and destained to visualize bands [18].

2.9. Amino acid composition

 The pigeon pea fat-free unhydrolysed control and protein hydrolysates (AH and EH) were digested with 6 M of HCl for 24 h. Then, AA composition was assessed using HPLC 1260 Infinity Agilent system, USA, based on a method previously described [19]. Cysteine and methionine contents were assessed post performic acid oxidation as described previously [20] and the tryptophan content was assessed as described by Li et al. [8].

2.10. Assessment of functional characteristics

2.10.1. Water and oil absorption capacities

Water absorption capacities (WAC) of the protein was assessed [17, 18] and then calculated using Eq. 7:

                                    Eq. 7

Where, W was the protein weight, V1 was quantity of the distilled water (DW) and V2 was volume of the water. For oil absorption capacities (OAC), 0.5 g of the samples were mixed with 5 mL of the appropriate vegetable oil and vortexed for 5 min. Slurry was centrifuged at 1968 g for 30 min and then weight of the adsorbed oil was assessed. The OAC was calculated using Eq. 8:

                                                 Eq. 8

Where, W was weight of the protein sample, W1 was weight of the oil and W2 was quantity of the free oil.

2.10.2.    Emulsifying activity index (EAI)

Emulsifying ability of the samples (unhydrolyzed, defatted and hydrolyzed) was carried out based on a method with modifications [19]. The EAI was calculated using Eq. 9:

                                      Eq. 9

Where, A0 was the absorption at 500 nm, φ was volume of the oil fraction, and C was protein concentartion of the sample.

2.10.3.    Emulsifying stability index

For emulsifying stability index (ESI), samples at a protein concentration of 1% were mixed with 9 g of vegetable oil (e.g. olive oil) and then homogenized for 5 min using ultrasonic cell crusher noise isolating chamber [19]. Two aliquots were pipetted at 0 and 10 min and further diluted with 5 ml of 0.1% SDS solution. Absorbance of the solution was recorded at 500 nm (in min) and was calculated using Eq. 10:

                                                   Eq. 10

Where, A0 was the absorbance at 0 min., A10 was the absorbance at 10 min, ∆t was the time difference of 10 min.

2.10.4 Foaming characteristics

Foaming characteristics were assessed, including foaming capacity (FC) and foaming stability (FS). Briefly, 200 mL of the sample solutions (unhydrolysed, defatted, and hydrolysates) with 0.5% protein concentration at various ranges of pH (2–10) were homogenized for 10 min using ultrasonic cell crusher noise isolating chamber and φ 6 probes to induce air at RT [20]. Generally, FC and FS were calculated using Eqs. 11 and 12:

                        Eq. 11

                         Eq. 12

Where, A was the volume before whipping (mL), B was the volume of foam at 0 min after whipping (mL) and C was the volume of foam at 20 min after whipping (mL).

2.11. Antioxidant characteristics

2.11.1 DPPH radical scavenging activity

For DPPH radical scavenging activity (DRSA), antioxidant activity was assessed using samples with a concentration of 1 mg·mL-1 that were mixed in water; 0.1 mg of DPPH-1:1 (v:v) was dissolved in 99.5% methanol [14]. Potential of the radical scavenging activity was assessed using absorbance at 517 nm and Shimadzu UV-1800, Nakagyo-Ku, Japan. In general, DPPH radical scavenging activity was calculated based on Eq. 13:

                   Eq. 13

Where, Asample was absorbance of the sample and Acontrol was absorbance of the control.

2.11.2. Hydroxyl radical scavenging activity

For hydroxyl radical scavenging activity (HRSA), nearly 100 μl of each sample with concentrations of 20–200 g were collected and mixed with 100 μl of ferrous sulphate (3 mM) and 100 μl of 1,10-phenanthroline (3 mM; dissolved in 0.1 M phosphate buffer; pH 7.4). Then, 100 μl of 0.01% hydrogen peroxide were added to the mixture to initiate the reaction. Mixture was incubated at 37 oC for 1 h and absorbance was measured at 536 nm using Shimadzu UV-1800 spectrophotometer, Nakagyo-Ku, Kyoto, Japan [14]. Equation 14 was used to assess hydroxyl radical scavenging capacity.

                           Eq. 14

Where, Asample was absorbance of the sample, Acontrol was absorbance of the control and Ablank was absorbance of the blank.

2.11.3. Metal ion-chelating assay

For metal ion-chelating assay (MCA), samples (100 μg) were mixed with 250 μl of 100 mM Na acetate buffer (pH 4.9) and 30 μl of FeCl2 (0.01%, w v-1). Ferrozine (12.5 μl, 40 mM) was added to the mixture after incubation at RT for 30 min. Generally, EDTA was used as positive control. Binding of Fe (II) ions to ferrozine generated a colored complex that was measured at 562 nm using Shimadzu UV-1800, Nakagyo-Ku, Kyoto, Japan [14,21,22]. The ferrous ion chelating ability was calculated using Eq. 15:

                                                                                Eq. 15

Where, Acontrol was absorbance of the control and Asample was absorbance of the sample. Reduced glutathione (GSH) was assessed (1 mg·ml-1) concurrently with the samples as positive control for all the antioxidant activity assays (DRSA, HRSA, and MCA).

2.11.4.    Assessment of reducing power

Reducing power of the protein was assessed based on a modified method [8]. Protein hydrolysate solutions with various concentrations (1, 5, 10 and 15 mg·ml-1) were prepared. Then, 1 ml of the vortexed sample was added to 2.5 ml of 0.2 M phosphate buffer (pH 6.6) and 2.5 ml of 1% potassium ferricyanide. Reaction mixture was rapidly vortexed and incubated at 50 °C for 20 min. Then, 2.5 ml of 10% TCA were added to the mixture and centrifuged at 12298 g for 10 min. Supernatant of 2.5 ml was mixed with 200 µl of deionized water and 40 µl of 0.1% FeCl3. This was set to react for 10 min and absorbance was measured at 700 nm using Shimadzu UV-1800, Nakagyo-Ku, Japan.

2.12. Assessment of anti-diabetic characteristic using α-amylase inhibition activity

Inhibition of α-amylase activity was assessed using a protocol with slight modifications [14]. Briefly, 6 mM of NaCl and 100 μl of 20 ml l-1 sodium phosphate buffer (pH 6.9) were mixed with 100 μl aliquot of the sample containing 1 mg ml -1 of α-amylase solution. Further, 100 μl of 1% starch solution in 20 mM sodium phosphate buffer (pH 6.9, 6 mM) were mixed with the sample and incubated. Reaction was terminated by the addition of 200 μl of dinitrosalicylic acid and incubated at 100 °C for 5 min using boiling water bath. The reaction mixture was cooled down to RT, followed by the addition of 3 ml of double DW. Absorbance of the samples, Control 1 and Control 2 was measured at 540 nm. A standard synthetic drug (Glyciphage) was used to compare the values. Inhibition proportion of α-amylase activity was calculated using Eq. 16:

       Eq. 16

Where, Control 1 represented mixture of starch solution, protein sample excluding α-amylase enzyme and Control 2 represented mixture of starch solution, α-amylase enzyme excluding protein sample.

2.13. Statistical analysis

Analyses were carried out in three independent replications, with the outcomes subjected to one-way variance analysis. Statistically significant differences (p ≤ 0.05) between the mean values were assessed using Tukey test and Origin Pro software v.8.1.

3.Results and Discussion

3.1. Proximate composition of pigeon pea

Crude fiber contents of unhydrolysed, defatted, acid, and enzyme hydrolysed pigeon pea seed samples were 7.56% ±0.96, 7.45% ±0.90, 7.10% ±0.80 and 6.95% ±0.80, respectively (Table 1). There was a little difference within the samples. The total ash contents were 3.76% ±0.46, 3.45% ±0.60, 3.97% ±0.70, and 4.05% ±0.60 for the highlighted samples, respectively.

For crude fat content, decreases in fat concentration were reported with a decreasing order from unhydrolysed to hydrolysate samples due to the extraction of defatted seeds using Soxhlet ethanol-based extraction, leading to the removal of fat in outer and inner pods of the seeds, which resulted in 4.45% ±0.50, 2.78% ±0.40, 2.18% ±0.50, and 1.95% ±0.50, respectively. Moisture contents of the samples were respectively 85.63% ±0.50, 78.2% ±0.50, 71.5% ±0.50, and 69% ±0.50 for unhydrolyzed, defatted and hydrolyzed samples [20].

3.2. Protein content

Protein content (PC) of the pigeon peas showed significant increase in hydrolysed seeds, compared to unhydrolysed (UH) seeds. Moreover, EH included a protein content of 24.05% ±0.5; AH included a protein value of 22.05% ±0.5 and UH included a protein content of 20.07% ±0.80. Significant increases in the total protein content of EH were recorded, compared with those of AH and UH (Table 2).

Technically, standard Kjeldahl method measures total protein content on a dry weight basis. From the previously reported studies, it is understood that the protein content changes when subjected to hydrolysis; however, there are mild changes in the protein content, depending on the used methods. Values reported in the current study indicated that they were within a similar range of 21–28%. With the help of hydrolysis, germination and soaking in improved varieties, significant increases were reported in protein contents [17, 20]. The protein bioavailability increased due to the hydrolysis achieved in a shorter time. The hydrolysates solid-liquid extraction method was a further efficient economically acceptable process for producing fish protein hydrolysates. Due to increased DH, it could hydrolyze proteins in a shorter time than enzymatic hydrolysis could [2, 8].

3.3. Degree of hydrolysis

Table 3 shows that the enzymatically produced hydrolysates included 68.42% ±0.48, better than unhydrolysed samples with 34.32% ±0.57  DH when treated with acids [6, 23]. Increased rate of hydrolysis during the later stages of hydrolysis might be because of increase in cleaved peptides that were unfolded and exposed further to AH surface area, allowing for easier proteolytic cleavages. In this study, it was observed that the extractable protein affected degrees of hydrolysis, which was similarly observed in a study by Abbe et al., 2022 [2]. The DH for EH were detected as 68.42 ±0.48. Annihilation of the protein natural secondary structure and cleavage of peptide fragments from the larger UH protein structure increased the protein solubility, indicating sharp increases in DH. Additionally, increased hydrolysis might result in further hydrophobic AAs unfolding, which enhanced surface hydrophobicity. Increased surface hydrophobicity could help the formulation textural probiotic encapsulation [24]. The EH and AH included better DH and higher protein content but EH included defined limitations for its effects on peptide characteristics such as hydrolysate, length of peptide, enzyme-substrate ratio, specificity of enzyme, hydrolysis time, molecular weight and bioactivity, as well as AA composition. Additionally, pre-treatment was needed to enhance hydrolysis as the cleavage sites were exposed with restrictions to higher exposure to heat, resulting in AA structures were deformed. Table 4 shows resulting barriers in the industrial sector due to it cost-ineffectiveness [25].

The study economic viability was assessed using a range of economic measures, one of the most important of which was the cost of manufacturing, sample preparation and total running expenses. The total operating costs was 3.65 USD/kg for AH and 52.48 USD/kg for EH, respectively (Table 4). With its competitive overall operative costs and good protein recovery yields, AH clearly was as the most economically viable agent.

3.4. Anti-nutritional factors

Tannic acid equivalents (mg·g-1) were assessed as 7.07, 6.46, 5.41 and 4.8 in unhydrolyzed, defatted and hydrolysed pigeon peas, respectively (Figure 1A). A study reported the range of tannin in unprocessed pigeon pea as 4.3–11.4
mg·g-1 [26]. Tannin-protein complexes have been suggested to cause decreased AA availability, increased fecal nitrogen, inadequate protein digestibility and decreased iron bioavailability. These complexes might not be separated, which caused them as eliminated with the wastes [27]. Hydrolysates effectively eliminated tannins from the protein complex and improved nutritional values of the hydrolysates. The total phenolic content was assessed as 1.88 mg 100 g-1, 1.504 mg·100 g-1, 1.45 mg·100 g-1 and 1.376 mg·100 g-1 for unhydrolyzed, defatted, acid and enzymatic hydrolysates, respectively (Figure 1A). Prior investigations reported 1.6 mg·100 g-1, which verified the reported values [26]. After hydrolysis (acid or enzyme), the OH group decreased significantly and enhanced bioavailability of the macronutrients, as revealed in similar studies where heat and acid treatments decreased quantity of the free form as well as bound phenolic compounds that even leached out in water, ultimately making dormant sites of the proteins active [28]. Phytic acid levels were assessed as 7.13, 6.175, 5.415 and 4.7 mg·g-1 for unhydrolysed, defatted, acid and enzymatic hydrolyzed forms, respectively (Figure 1A). A study reported that the phytic acid content of pigeon pea was assessed from 4.87 to 6.54 mg·g-1, similar to the current findings [26]. Based on studies, total free (unbound) mineral contents increased after the whole wheat bread was autoclaved and microwaved simultaneously and the quantity of phytic acid decreased [29].

Saponins belong to a complex class of naturally occurring triterpenes or steroidal glycosides, detected in numerous types of plants, including oil seeds and pulses. Since saponins change permeability of the cell walls, they may result in adverse effects when consumed. The small intestine cells are bound by saponin, which alters how nutrients are absorbed through the intestinal membrane [1]. Saponins were assessed to be 9 mg.g-1 for unhydrolyzed and 11.5 mg.g-1 for the enzymatic hydrolysates. Similar values were reported in previous studies by Sekhon et al. [26]. Saponins include positive correlations with HRSA. This study highlighted that similarly hydrolysates included higher values than those unhydrolysates did. Saponins are well known for their capacity to yield foam that is exceptionally stable [3]. Trypsin inhibition activity of the unhydrolyzed samples was lower than that of hydrolysed samples (Figure 1B) [30]. After hydrolysis of H-bonds, trypsin-protein complexes were undigested, leading to decreases in inhibitors. These studies justifies relevance of the assessment of inhibitors as they delay the metabolism; hence, it must be addressed while consuming legumes as the source proteins. It is reported that trypsin-protein complexes are undigested after the lysis of H-bonds and decreases in inhibitors [21]. Studies on trypsin protease inhibitors (tannins, phytates, trypsin inhibitors and goitrogens) have shown their interference with the digestion processes and production of pancreatic hypertrophy or hyperplasia, inhibiting growth of the epithelial cells that lining mucosa and thus including anti-nutritive effects. Various methods have been used in food processes to address effects of these food anti-nutrients, including milling, soaking, germination, autoclave and microwave treatments and fermentation [31].

3.5. Fourier transform infrared spectrum analysis

Secondary structure of the proteins was assessed using FTIR spectroscopy [30]. Figure 2A shows that spectral characteristics of the globular complex (GC) proteins in unhydrolyzed samples were the Amide-A band at approximately 3274.31 cm-1 (NH stretching), the Amide-B band at approximately 2854.99 cm-1 (C-H symmetric stretching modes of methyl), the amide-I band at 1743 cm-1 (C=O carbonyl stretching), the amide-II band at 1634 cm-1 (C=C aromatic stretch) and N–H bending at 1540 cm-1 and the aromatic C-H in plane bend at 1074.88 cm-1. These findings were consistent with the previous studies [17, 31]. The AH spectra showed characteristic peaks in the range of 3273–2874.17 cm-1, indicating that respectively Amide A (N-H and C-H stretching) and Amide B (methyl C-H stretching) bands brought on by the bending resonances of the intra and intermolecular hydrogen bonds (Figure 2B). Peaks at 3231.46, 3065.45, 2958.78 and 2875.78 cm-1 showed that Amides A and B were visible in the IR spectra of EH (Figure 2C). The aromatic C-H out of the peaks were visible at 666.10 and 1398.04 cm-1 indicating N-O aliphatic stretch. Moreover, peak of 1451.70 cm-1 showed visible peaks of C-H asymmetric bend, and 1579.13 cm-1 showed a band of the NH bend (Figure 2C). The connection between functional groups of C-O and N-H forms a helical structure [32]. 

The conventional protein bands of Amide I (1600–1700 cm-1), Amide II (1500–1580 cm-1) and amide III (1200–1400 cm-1) showed visible bands of Amides A and B. A previous study showed that the characteristic protein bands were linked to specific stretching and bending vibrations of the protein backbones. The α-helix (1650–1658 cm-1) and β-sheet (1638–1687 cm-1) were the primary contributors to Amide I, while Amide II was mostly caused by N-H bending vibrations (60%) connected to C-N stretching vibrations (40%), representing dominance of the protein contents [33]. Therefore, peaks (1300, 1650 and 1688 cm-1) investigated in the hydrolysate spectra were similar to α-helix and β-sheet [4, 17].

3.6. Protein Profile Analysis (SDS-PAGE)

In vertical gel electrophoresis, proteins are separated based on their molecular weights. In this study, acid and enzymatically hydrolyzed pigeon pea samples were subjected to SDS-PAGE (15%) to assess molecular weights of the hydrolysates. Protein marker (Lane 1) ranged 245–11 kDa which included various molecular weights, followed by acid samples in Lane 2, unhydrolysed samples in Lanes 3 and 4 and enzymatic hydrolysates in Lane 4. Acid hydrolysed samples showed distinct bands in the range of 250–20 kDa (Lane 2), which were suggested as albumins and globulins and the difference in molecular weights showed the extraction procedure, making them high-molecular weight (HMW) peptides. The control unhydrolyzed protein demonstrated intense bands at 135–100 kDa (Lanes 3 and 4). The SDS-PAGE analysis of the EH revealed generation of low-molecular weight (LMW) peptides with a mass range of less than 15 kDa (Figure 3, Lane 5).

Figure 3 illustrates differences in bands affected by hydrolysis differently. Thus, it could be assessed that LMWs were produced by breaking the complex protein structure and peptide bonds by use of AH conditions while enzymatically hydrolysed samples included the presence of LMW peptides, indicating complete hydrolysis of the pigeon peas. A similar LMW band was seen in casein and flaxseed hydrolysate studies [10, 11].

3.7. Amino acid composition

The AA compositions of pigeon pea unhydrolysed (UH), acid (AH), and enzymatic hydrolysates (EH) are shown in Table 5.

The current composition supports protease ability to specifically cleave proteins at peptide bonds that hydrophobic AAs contribute to, increasing quantity of the linked AAs [16]. The pigeon pea unhydrolysed AA profile showed that the legume was rich in proteins and included significant quantities of EAAs that were better than the needs of the World Health Organization/Food and Agriculture Organization/United Nations University (FAO/WHO/UNU) Expert Consultation [10]. Findings from this study revealed greater concentrations of hydrophobic AAs (38.4 and 37.88%), EAAs (39.68, 42.26%), sulphur containing AAs (2.52 and 1.29%) and aromatic AAs (9.89 and 11.69%) for unhydrolyzed and enzymatic hydrolyzed samples, respectively. These were

similar to previous findings by Nwachukwu et al. for the flaxseed protein and thermoase hydrolysates (8.62 and 9.03% of aromatics; 34.55 and 35.72% of hydrophobics) [34].

Comparison of AA profiles of the protein hydrolysates derived by the isoelectric precipitation method to native protein (unhydrolysed pigeon pea) revealed a little detectable variation, suggesting that the protein composition was largely unaffected by the extraction process [30]. Olagunju et al. [14] detected that use of distinct proteases during the hydrolysis of pigeon pea protein produced similar findings. The hydrolysates included higher concentrations of particular AAs, compared to those the non-hydrolyzed protein did, including glutamic acid, histidine, leucine, isoleucine, phenylalanine, arginine, tyrosine, and tryptophan. Glutamic and aspartic acids were the most frequent AAs in AH and EH, whereas levels of tryptophan and methionine were below the recommended levels. Branching-chain amino acids (BCAAs) and a majority of hydrophobic AAs (glycine, alanine, valine, leucine, isoleucine, proline, and phenylalanine) increased upon enzymatic degradation using protease enzymes.

3.8. Functional characteristics of bioactive peptides

3.8.1. Water and oil absorption capacities

Technically, WAC and OAC are pH dependent and detrimental parts of this study. The WAC values of the hydrolysates were higher than those of unhydrolysed samples. At pH 4, sharp decreases were seen in WAC and OAC values due to the pH near the isoelectric point of the proteins (Figure 4A). Similar findings were reported by the literatures, showing that peptides typically included higher water-holding capacities than those of their associated flour forms. This finding was similar to another finding and likely resulted from changes in protein conformation that exposed further water-binding sites, increasing protein polarity, electric charge and proportion of the proteins bound in water [4, 17]. The OAC value is important as an estimate of oil ability to absorb proteins, which can indicate how hydrophobic a protein is. The non-protein components in flours, including starch granules and lipids, may partially function as a barrier to water penetration, fractions with higher protein contents with fibers include greater potentials to hold water. Due to their lower lipid contents and smaller particle sizes, lentil protein peptides included better water-holding capacities than those the lentil flours did.

The OAC of pigeon pea unhydrolysed seeds was lower than that of the enzymatic hydrolysate with significant general decreases at pH 4 (Figure 4A). Compared with other spectra of legumes, these values were at average levels, as reported in a study of protein hydrolysates with higher surface hydrophobicity and better surfactant characteristics. However, denaturation of the globular proteins might expose hydrophobic regions. It is believed that OAC is created by the binding of non-polar side groups of proteins, leading to oil entrapment. The OAC is therefore affected by the quantity of hydrophobic AAs that are exposed, as well as the quantity of hydrophobic AAs in the proteins that can visibly be demonstrated in the AA profile (Table 5 ) for the unhydrolysed and hydrolysed samples [3, 20, 35]. Based on a study, globular proteins with further hydrophilic and polar AA residues on the surface included a higher WAC and proteins with further hydrophobic and non-polar AA residues might include a higher OAC [36]. Plant-based proteins with good water and oil absorption characteristics can create plant-based protein analogues and emulsions, which are beneficial in food industries.

3.8.2. Emulsifying capacity

The EAI (Figure 4B) and ESI (Figure 4C) values of the hydrolysed samples were higher than those of unhydrolyzed and defatted samples, which was observed with pH as a critical factor. The lowest EAI and ESI values were reported at pH 4, which was near the isoelectric point of soy and whey proteins and included a lesser solubility based on Figures 4B and 4C, respectively. This indicated that pH substantially affected emulsifying characteristics of the peptides with and without hydrolysis. Stability of the emulsion increased by pH levels that were below the isoelectric point. The maximum EAI and ESI values for the emulsions at pH 8 are shown in Figures 4B and 4C [19]. It is shown that the hydrophilic/hydrophobic AA composition and equilibrium development of the interfacial film, as well as the solubility and flexibility of the protein molecules, are interrelated to differences in EAI and ES for various proteins [37]. Protein isolates with higher EAI and ES additionally included further hydrophilic AA residues and were further soluble (Figures 4B and 4C). Amphiphilicity of the peptides includes major effects on the emulsifying abilities of hydrolysates. Based on multiple studies, hydrolyzed peptides enhance hydrolysates abilities to emulsify due to their potentials to unfold at the oil/water interface [37]. Additionally, they are more likely to include residues that interact with the aqueous phase and the oil droplets, respectively, whether they are hydrophobic or hydrophilic [2, 14]. Due to steric effects, this interaction makes the emulsion further stable [38]. The AH offers further potentials for food emulsion uses, including yoghurt, mayonnaise and ice cream since EAI and ESI are essential indices for food emulsion use and quality control. Moreover, higher molecular weight of the protein hydrolysates may result in higher emulsion capacities of AH.

3.8.3. Foaming characteristics

Proteins in dispersions decreased surface tension at the water-air interface, resulting in the ability to foam. The hydrolysates half-life could be changed by the preservation of the viscoelastic adsorbed layer, suggesting that FS might necessitate addition of functionality improvers to the hydrolysate. It is well known that globular proteins frequently produce adsorbed layers that are elastic with enhanced viscosity and hence support stability of the foam [39]. Foaming capacity and stability are pH dependent. The FC decreased at pH 4 and reached its maximum value at pH 6 (decreased in alkaline conditions). The FC was inversely proportional to pH. At pH 6, net charge increased, which led to increases in foaming capacities. At pH 4, FC achieved a lower solubility at its isoelectric point. Increased concentrations of amphiphilic peptides contributed to increased FC (Figure 4D). Moreover, FS depended on protein-protein interactions with the matrix [20]. An extensive intermolecular network (protein-protein interactions) preserved by proteins maintained their tertiary structures at the interface, resulting in strong films and further stable foams.

Protein LMWs and other structural characteristics helped generate foams further quickly. However, they might not be effective for creating protein-protein interactions that resulted in stable foams (Figure 4D). These reports help explain why the unhydrolysed control pigeon pea included a small foam ability (expansion of foam) [37]. Large concentrations of hydrophobic AAs could be the reason for decreased FC values. Stability of the foam formation was affected by the strength of protein films and permeability for gases [18]. Several peptides with various hydrophobicity, charge balances and conformations from the native molecule are created during the digestion of proteins. These peptides are more flexible due to their lower molecular weight; hence, a stable interfacial layer is seen and the rate of diffusion to the interface increases, improving the foamability characteristics. For a protein to foam effectively (e.g. including high foamability), it should adsorb quickly during the transient stage of foam formation. These findings revealed increases in surface activity, most likely due to the originally larger surfaces created by partial proteolysis that allowed for the incorporation of further air [39].

3.9. Antioxidant activities of peptides

Several chemical or biological assays are needed to assess antioxidant mechanism and quantify antioxidant activity of the legume extracts [40]. Although this in-vitro study is fascinating from a strictly predictive viewpoint based on chemical processes, it might sometimes correspond to in-vivo systems. The MCA and HRSA are based on electron transfer reactions (ET) and hydrogen atom transfer reactions (HAT), respectively; DPPH is a hybrid HAT and ET-based assay [7].

3.9.1. The DPPH radical scavenging activity

Due to the method simplicity, efficacy and credibility, DRSA is often used to assess antioxidant capacity of foods, peptides and biological samples. In the present study, DRSA in pigeon pea samples was 38.60, 42.45, 74.25 and 80% for unhydrolysed, defatted, acid and enzymatic hydrolysates, respectively (Figure 5A). Results were almost similar to those of literature. The DRSA of hydrolysates was able to achieve a similar efficiency to that of GSH, which is the predominant intracellular antioxidant that helps in keeping redox equilibrium in the body and as well as modulating cell viability. Other studies have reported similar increase in antioxidant activity with increase in DH. Increased hydrolysis led to further hydrophobic side chains exposed, improving DRSA. Moreover, positive correlations were recorded between the phenolic content and DRSA, which justified the oxidative stress decreases on cellular levels. Relatively, as phenolic substances or their respective levels of hydroxylation increase, their abilities to scavenge DPPH radicals increase as well. Free radicals combine with cellular components such as DNAs, proteins and cell membranes; hence, these metabolites (primary and secondary) solve the problem of oxidative stress by neutralizing and disguising them as harmless agents through biological processes [10, 40].

3.9.2. Hydroxyl radical scavenging activity

Technically, HRSA assesses scavenging ability of peptides when hydroxyl radicals are generated due to the reaction between H2O2 and metal ions such as Fe2+ ion form. Hydroxyl ion includes short lifespan and highly reactive species that degrades macromolecule proteins, DNAs and lipids. Hydroxyl ion is addressed as a responsible factor for initiating lipid oxidation processes, causing cell damages that result in ageing and other chronic illnesses. Scavenging abilities of pigeon pea unhydrolyzed, defatted, acid, and enzymatic hydrolyzed samples were 38.55, 40.2, 45.15, and 50%, respectively (Figure 5A). In the current study, HRSA showed similar results to those of DPPH and phenolic contents did in the samples. Total length of the peptides, makeup and sequencing of the AAs and other variables alter antioxidant activity of protein hydrolysates. It can be concluded from the results that hydrolysis enhanced the hydroxyl radical scavenging capacity of pigeon pea proteins; similar to that observed in the enzymatic hydrolysis of pigeon pea using various enzymes [23].

3.9.3. Metal ion-chelating assay

Transition metal Fe2+ stimulates production of OH- and superoxide radicals (O2), triggering oxidative chain reactions. Chelating chemicals regulate the oxidative chain reactions caused by the radicals and decrease quantity of transition metals available in organic materials. The Fe2+ Scavenging ability of the hydrolysed samples was similar to that of GSH and significantly better than that of unhydrolysed samples [8]. The current study indicated that metal chelating abilities were high; similar to other studies that verified hydrolysate antioxidant abilities could inhibit oxidant reactions and help in prolonged storage. Increased hydrolysed peptides or polar AA concentrations might be associated with increased Fe2+ chelating activity within hydrolysis. Protein hydrolysate ability to chelate metal ions is generally reported responsible for their abilities to bind with ions. It has been stated that histidine-containing peptides include metal-chelating activities via their imidazole rings. Another significant reason for antioxidant activity included ability to bind transition metals because transition metal ions such as Fe2+ and Cu2+ naturally stimulate creation of reactive oxygen species (ROS) such as hydroxyl radical (OH), triggering oxidation of fatty acids [23].

3.9.4. Reducing power

The reducing power of a compound is studied to assess its antioxidant potentials. Figure 5B demonstrates the reducing power reached by acid-base hydrolysis for 5 h at various doses (1–15 mg·mL-1). Hydrolysates included the highest reducing power, showing that these hydrolysates in EH followed by AH included further bioactive peptides that could scavenge free radicals. The activity assessed by UH was the lowest. Reducing power of the samples increased with a higher absorbance value. When reducing substances were present, the Fe3+/ferricyanide complex was reduced to the ferrous form (Fe2+) through electron donation. Briefly, quantity of Fe2+ was measured at 700 nm [7]. Variation in reducing power might be a significant characteristic, indicating changes in AA composition after hydrolysis. Information suggested that hydrolysates might help free radicals by donating one electron [8].

3.9.5. Anti-diabetic assay

In general, α-amylase enzyme in hydrolysis of glycosides is responsible for the breakdown of complex carbohydrates into oligosaccharides and glucose for a better uptake. Hence, inhibition of such an enzyme is helpful in decreasing breakdown of complexes to simpler levels, making it a better strategy to manage diabetes. For this reason, naturally occurring bioactive substances in foods that are helpful in treatment of diabetes have widely been reported. Figure 6 shows that various samples included anti-diabetic activities. The synthetic drug glyciphage showed the highest inhibition rate (56%), whereas hydrolysates EH (44%) and AH (38%) showed the best inhibitory effects, compared with the activity of UH (18%) and DF (22%). Low activities of the UH and DF might be due to weaker bond interactions, including electronic and hydrophobic bonds with lesser bond availability to bind with polysaccharides and dietary fibers, ultimately leading to lesser inhibition. After hydrolysis, synergistic activities between the peptides and inhibition were recorded. Results

were similar to those of various hydrolysates. Although studies have shown certain differences in inhibition due to the sources of raw materials, filtration process and type of hydrolysis, inhibiting activity of α-amylase may lessen the likelihood of hyperglycemia in the body [14].

4. Conclusion

This study highlights synthesis of functional proteins with comparative findings of the various methods. Effectiveness of pigeon pea as a potential alternative protein source was the major finding of this study as well as assessment of the peptide functional, antioxidant and anti-diabetic characteristics. This study has demonstrated use of acid and enzymatic hydrolysis methods for the extraction of pigeon pea protein hydrolysates to subdue anti-nutritional factors that delay efficacy of metabolism. This approach can be used as an excellent alternative to traditional proteins with a higher concentration of bioactive peptides. It has been observed that the bioactive peptides include beneficially functional qualities such as helping in developments of emulsions, gels and suspensions, making them ideal choices for potentially commercial protein powders. This study provides numerous novel possibilities for research on plant-based protein sources and pigeon pea can be used as a vegan source while preserving the protein texture, flavor and nutritional profile. These help in treating various chronic diseases and metabolic disorders; hence, contributing significantly to health and food industries. The present study addresses usethe use of cheaper vegan protein sources in human diets.

5. Acknowledgements

None.

6.Conflict of Interest

The authors declare no potential conflict/competing interest.

7. Authors Contributions

Conceptualization, N.S.; methodology, J.M.; software, J.M.; validation, N.S..; formal analysis, J.M.; investigation, J.M.; resources, N.S.; data curation, writing—original draft preparation, J.M..; writing— review and editing, N.S. and V.G.P.; visualization, N.S.; supervision, N.S.

 

Synergistic effects of recombinant AGAAN antimicrobial peptide with organic acid against foodborne pathogens attached to chicken meat

Nafiu Usman Jiddah , Ya'u Sabo Ajingi, Neeranuch Rukying, Triwit Rattanarojpong, Worapot Suntornsuk, Patthra Pason, Nujarin Jongruja

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e21
https://doi.org/10.22037/afb.v11i1.44981

Background and Objective: Fresh chicken meat includes the capacity to contain foodborne pathogens. A previous study has demonstrated efficacy of recombinant AGAAN antimicrobial peptide against various bacterial strains. In general, AGAAN is a newly discovered antimic-robial peptide with a unique cationic alpha-helical structure. The peptide is originated from the skin secretions of Agalychnis annae. This peptide showed a significant affinity towards the negatively-charged microbial lipid bilayer, as previously demonstrated by the experimental and in-silico analyses. However, the major concerns include high production costs, limited expression, laborious process and potential toxicity associated with concentrated peptides. In this research, the synergistic effects with organic acid were addressed to decrease these problems while preserving its bactericidal activity.

Material and Methods: Recombinant AGAAN and organic acids were assessed on Staphylococcus aureus ATCC 6538 and Escherichia coli ATCC 8739. This was carried out by assessing minimum inhibitory concentration and fractional inhibitory concentration. In addition, effects of the combination on bacterial membrane integrity by carrying out beta-gala-ctosidase assessment. Additionally, the potential efficacy of this combination in preserving poultry meat was investigated.

Results and Conclusion: Minimum inhibitory concentration of the recombinant AGAAN against the two bacterial strains was 0.15 mg.ml-1. In contrast, the minimum inhibitory concentration of acetic acid against Staphylococcus aureus and Escherichia coli were 0.2 and 0.25% v v-1, respectively. The combination demonstrated significant synergy, as evidenced by fractional inhibitory indices of 0.375 against the two foodborne pathogens. Based on the study, the combination effectively inhibited proliferation of these disease-causing microorganisms that led to foodborne illnesses within 300 min. Presence of intracellular beta-galactosidase indicated that the combination of factors has caused damages to the cell membrane, resulting in its compromised integrity. Red blood cells exposed to various concentrations of recombinant AGAAN and acetic acid did not result in hemolysis. Results showed significant differences (p < 0.05) in all the experiments on meat samples that received treatments with recombinant AGAAN and acetic acid. The current study detected that a combination of recombinant AGAAN antimicrobial peptide with organic acid could effectively inhibit growth of pathogens at lower concentrations. Data presented in this study can help food industries develop further efficient cost-effective antimicrobial uses.

  1. Introduction

 

Prevalence of foodborne diseases has emerged as a significant global health concern. The World Health Organization (WHO) report indicates that nearly 600 million cases of foodborne illnesses occur annually due to the consumption of food substances contaminated with microorganisms and chemicals [1]. Food contamination and increases in the risk of foodborne diseases are caused by pathogenic microorganisms [2]. Meat and meat products are important sources of nutrients for humans due to their high protein composition and other essential nutrients [3].  However, these foods provide appropriate environments for the growth of foodborne microbes due to their high water content and nutrients, [4]. A significant number of studies have shown that Staphylococcus aureus and Escherichia coli are associated with meat contamination [5-7]. The S. aureus is a facultative anaerobic, Gram-positive non-spore-forming bacterium [8]. It is a major problem in foodborne illnesses [9]. The S. aureus infections cause significant morbidity and mortality in developing and developed countries [10]. Similarly, E. coli is a non-spore-forming bacterium and the major cause of foodborne diseases in Gram-negative bacteria. Disease-causing strains of E. coli can infect the stomach, leading to serious abdominal symptoms [11]. Previous studies have primarily concentrated on spore-forming microorganisms, thereby overlooking non-spore-forming ones such as E. coli and S. aureus. Based on their contribution to foodborne illnesses, it is important to develop a cost-effective user-friendly approach to slow their rapid proliferation in food products.

Organic acids have been used as antimicrobial agents to inhibit foodborne pathogenic bacterial growth in chicken meats during processing [12]. Due to the potential resistance development by microorganisms, there are needs of drug alternatives that can efficiently kill resistant bacteria and enhance preservation [13]. Antimicrobial peptides (AMP) are produced by living organisms and include critical functions in protecting hosts against infections [14,15]. Likelihood of microbes exhibiting resistance to AMP is exceedingly low because of their wide range of mechanisms of action. Multiple studies have emphasized potential of AMP as a viable option for preventing meat spoilage and foodborne diseases [16-19]. In a previous investigation by the current authors, recombinant AGAAN (rAGAAN) effectively was cloned, expressed and analytically characterized [20]. Technically, AGAAN is a novel antimi-crobial peptide with a cationic α-helical structure from the skin secretions of the blue-sided frogs. The rAGAAN is stable at various temperatures and pH and destroys a wide range of bacteria [20]. A hemolytic assay has shown that the peptide is relatively non-toxic to mammalian red blood cells (RBCs). Combination of these characteristics with its rapid killing kinetics demonstrates that rAGAAN includes the potential as an effective food preservative against foodborne pathogens. Nevertheless, major issues include exorbitant production expenses, labor-intensive procedures and potential toxicity of using high concentrations of peptides.

Combining two or more AMPs may boost antimicrobial activity at lower doses [21]. The present study assessed pairwise combinations of the rAGAAN with formic and acetic acids against E. coli and S. aureus. Selection of these two organic acids was based on their high effectiveness against the highlighted bacterial strains. In addition, FAO/WHO Expert Committee on Food Additives has classified acetic and formic acids as generally regarded as safe. The former chemical was assigned to an unrestricted group acceptance daily intake (ADI), while the latter was assigned to an ADI range of 0–3 mg.kg-1 [22]. Combination of rAGAAN and these organic acids could decrease the concentration while preserving their potentially bactericidal activity. Differences in their mechanisms of action necess-itate assessment of synergy in membrane permeation and kinetics of inactivation. This study could provide an additional option for poultry industries to protect chicken meats from pathogens.

  1. Materials and Methods

2.1 Bacterial strains

Department of Microbiology at King Mongkut's University of Technology Thonburi in Bangkok, Thailand, supplied the foodborne pathogenic strains of E. coli ATCC 8739 and S. aureus ATCC 6538.

2.2 Recombinant AGAAN peptide expression and purification

The rAGAAN was produced based on the method of Ajingi et al., [20]. Briefly, the recombinant plasmid (pET-AGAAN) was transformed into E. coli BL21 (DE 3) competent cells. A colony of the competent cells with recombinant plasmids was inoculated into Luria-Bertani (LB) broth supplemented with chloramphenicol and ampicillin and grown at 37 °C and 200 rpm overnight. Then, 1% v v-1 from the overnight culture was introduced into a fresh 1-l LB broth supplemented with chloramphenicol and ampicillin as well as 1% w v-1 glucose. Culture was grown to an optical density (OD 600 nm) range of 0.4–0.6 at 37 °C and 200 rpm. Then, rAGAAN was expressed through induction with isopropyl β-D-1-thiogalactopyranoside at a concentration of 500 mM. Culture was grown at 16 °C for 18 h at 150 rpm. Cells were collected through centrifugation at 6,120× g for 30 min at 4 °C. Then, cells were suspended in 10 ml of buffer solution (10 mM Tris-HCl, 1 M NaCl; pH 8.0). These were subjected to sonication at an amplitude of 60% for 2 min, repeated for five cycles to induce cell disruption. Supernatant was purified after sonication and centrifugation at 6,120× g for 25 min at 4 ℃ using HisTrap FF column linked to the FPLC system. The column was pre-equilibrated with binding buffer (10 mM Tris-HCl, 1 M NaCl; pH 8.0). Elution of the bound peptide was carried out using buffer B (10 mM Tris-HCl, 1 M NaCl, 250 mM imid-azole; pH 8.0). Then, dialysis was carried out overnight at 4 °C using 50 mM Tris-HCl solution. Then, peptide was concentrated using 3-kDa centricon centrifugal filter tubes (Amicon, Germany). Concentration of the rAGAAN was measured using Bradford protein assay and its purity was assessed using 16% tricine-sodium dodecyl sulfate–polyacrylamide gel electrophoresis (tricine-SDS-PAGE).

2.3 rAGAAN and organic acid preparation

The rAGAAN was formulated in milligrams per milliliter (mg.ml-1). It was dissolved in 1× phosphate-buffered saline (PBS), whereas the organic acids were formulated in percentages (% v v-1) by dissolving in distilled water (DW).

2.4 Culture preparation

A volume of 20 μl of microbial stock, previously stored at -80 ◦C, were plated on LB agar. The resulting culture was incubated at 37 oC for 18 h. Then, subculture process was carried out for each strain under identical conditions to preserve integrity and purity of the cells. On the next day, a suspension was generated by transferring isolated colonies into sterilized 10-ml LB media. The bacterial strains were cultured until they reached an OD of 108 cfu.ml-1. This measurement was achieved at 600 nm using spectrophot-ometer (U-2900UV/VIS Hitachi Tokyo, Japan). Concen-tration was modified to 105 cfu.ml-1 using sterile LB broth.

2.5 Minimum inhibitory concentration assessment

Briefly, 50 μl of the inoculated sample were administered into each well of the 96-well plates. Then, aliquots of 50 μl were dispensed into the wells, containing rAGAAN and organic acids at various concentrations. The 96-well plates with the lids closed were incubated at 37 °C for 18 h. Results were analyzed at 600 nm using microplate reader (BioTek, synergy H1, Winooski, USA). Control contained 100 μl of the bacterial inoculum. The MIC values included the lowest concentrations of the antimicrobial agents that cause bacterial growth inhibition.

2.6 Synergistic effects of rAGAAN with acetic and formic acids

Combination effects of rAGAAN with organic acids against the bacterial strains were assessed using checkerboard method. Briefly, 18-h cultures in LB broth were used to inoculate fresh LB broth to achieve a cell density of approximately 105 cfu.ml-1. Generally, 50 μl of the inoculated sample were added into 96-well microplates. Then, rAGAAN and organic acids were transferred into the 96-well microplates with increasing concentrations arran-ged in columns and rows, respectively. The organic acids were mixed with rAGAAN separately to assess their combinatorial effects on pathogenic bacteria. The purpose was to decrease the effective concentration of rAGAAN while preserving its antimicrobial activity. Assessment of the synergistic interactions involved the summation of the fractional inhibitory concentration indices (FICI) as Eq. 1 [23].

                                                                                                 Eq. 1

where, FICI ≤ 0.5 indicated synergistic relationships between the rAGAAN and organic acids that increased the antimicrobial activity, FICI > 0.5–4.0 was indifferent and FICI > 4.0 was antagonistic.

2.7 Kinetics of inactivation

The OD of bacterial strain was measured to assess the rate of inactivation when treated with rAGAAN, acetic acids or their combination. Bacterial culture, diluted in LB broth to a concentration of approximately 105 cfu.ml-1, was added to 96 well plates. The rAGAAN and acetic acid were added at their minimum inhibitory concentration (MIC) levels, individually and in combination with their fractional inhibitory concentration (FICI) at 1×, 2× and 3× to separate wells. The 96-well plate was incubated at 37 °C. The procedure entailed monitoring the rate of inactivation for various bacterial strains by measuring the OD at consistent intervals of 1 h for 5 h. The OD was measured using spectrophotometer set at 600 nm and microplate reader (BioTek, synergy H1, Winooski, USA).

2.8 β-Galactosidase assay

The β-galactosidase assay was carried out to assess effects of the rAGAAN and acetic acid or their combination on membranes of the bacteria. First, E. coli was inoculated into lactose broth and incubated at 37 °C for 18 h to stimulate β-galactosidase production. The bacterial cells were centrifuged and the pellet was washed thrice with 1× PBS. Then, the bacterial concentration was modified to roughly 105 cfu.ml-1 in 1× PBS solution. Moreover, 50 μl of purified rAGAAN, acetic acid and their combination at 1× FICI, 2× FICI and 3× FICI were added into wells of a microplate containing 50 μl of E. coli cell suspension. A volume of 30 μl of O-nitrophenyl-β-D-galactoside (ONPG) were added into every well of the microplate. The microplate was incubated at 37 °C and activity was assessed by measuring the spectrophotometric absorbance at 405 nm and various time intervals.

2.9 Hemolysis assay

The RBC lytic assay was carried out based on a procedure by Taniguchi et al. [24] with minor adjustments. The RBCs were washed thrice in 1× PBS and centrifuged at 14,530× g for 10 min. Pellet was dissolved in 1× PBS to achieve a concentration of 4%. Generally, 500 μl of blood were mixed with 500 μl of rAGAAN and acetic acid, indivi-dually and in various combinations (1×FICI, 2×FICI, and 3×FICI). The positive control included a solution containing 0.1% TritonX-100, while the negative control included a solution containing 1× PBS. Solution was incubited in microtubes at 37°C for 1 h and centrifugation was carried out at 14,530× g for 5 min. Then, 100 μl of the supernatant were extracted from each microtube and transferred to each well of 96-well plate. Assessment of hemoglobin release was carried out by measuring the absorbance at 540 nm.

2.10 rAGAAN-acetic acid against chicken meat spoilage

Antimicrobial efficacy of the rAGAAN and acetic acid combination was assessed using a methodology described by Ajingi et al. [25], with minor adjustments. In brief, fresh chicken meat was purchased from a local market and immediately transferred to the laboratory. Meat was divided into approximately 10-g specimens and washed thoroughly. Specimens were transferred into a laminar flow hood and 100 µl of 105 cfu of E. coli were divided to five separate locations. Sample was set for 1 h to promote appropriate attachment of the bacterial strains. Then, meat sample was submerged into 200-ml solution of rAGAAN/acetic acid for 1 h. Furthermore, sample was extracted, transferred into a plastic bag and incubated at 37 oC for 3 d. The chicken meat sample was transferred into a plastic bag with solution consisting of 0.1% peptone water. Sample was mechanically pulverized using stomacher to enhance liberation of the bacterial cells. Following the process of serial dilution, a 100 µl of sample were transferred onto an LB-agar plate. Number of colonies on the plate was counted at intervals of 0, 1, 2 and 3 d. Control group was administered with DW.

2.11 Statistical analysis

Results were present as mean ±SD (standard deviation) of three replicates. Statistical distinction was assessed using one-way analysis of variance (ANOVA) with Duncan’s multiple-range test. Differences with p < 0.05 were regarded as statistically significant.

  1. Results and Discussion

3.1 Minimum inhibitory concentration

The MICs of rAGAAN and organic acids against S. aureus and E. coli are present in Table 1. The MIC of rAGAAN against S. aureus and E. coli was assessed as 0.15 mg.ml-1. The organic acids inhibited proliferation of the pathogenic bacteria at various concentrations expressed as proportions (%).

Acetic acid demonstrated inhibitory effects on the growth of S. aureus at 0.2% v v-1 and on the growth of pathogenic E. coli at 0.25% v v-1. Formic acid inhibited growth of S. aureus at 0.25% v v-1 and growth of E. coli at 0.2% v v-1. The findings for acetic acid were similar to those against eleven mastitis pathogens in dairy cows with MIC values ranging of 0.125–0.25% v v-1 [26]. Similarly, Fraise et al. [27] reported antimicrobial activity of acetic acid against Pseudomonas aeruginosa and S. aureus at 0.166 and 0.312% v v-1, respectively. Manuel et al. [28] detected that formic acid at a concentration of 0.06% v v-1 exhibited antimicrobial effects against E. coli. Variations in their effectiveness against the microorganisms might be attributed to their chemical compositions. Methyl group (CH3) in acetic acid donated electron density to O-H bond, resulting in increased difficulties in removing the hydrogen atom. Consequently, acetic acid was weaker than the formic acid. Weak acids included a higher ability to pass through bacterial membranes, compared to strong acids due to the balances between their ionized and non-ionized states. The non-ionized form could easily diffuse through hydrophobic membranes. As a result, they provided proton gradients needed for ATP synthesis to collapse. This occurred because free anions such as acetate in this situation combined with periplasmic protons that were pumped out by the electron transport chain. Then, anions transported the protons back across the membrane without F1Fo ATP synthase [29].

3.2 Synergistic effects of rAGAAN with organic acids

The inhibitory concentration index (FICI), demons-trating combined effects of rAGAAN and organic acids, is present in Table 2. The compound rAGAAN demonstrated synergistic effects against S. aureus and E. coli when combined with organic acids. Results showed that the synergistic effects were strongest when using acetic acid for the two bacterial strains, compared to when using formic acid. The FICI values for the combination of rAGAAN with acetic acid were assessed as 0.375 (p < 0.5) for S. aureus and E. coli. The FICI values for the combination of rAGAAN with formic acid were assessed as 0.375 for S. aureus and 0.5 for E. coli.

 

 

 

 

Results indicated that sub-MICs of the antimicrobials were needed to effectively terminate the bacterial growth. Combination of rAGAAN and acetic acid resulted in a 25% decrease in the concentration of each antimicrobial, compared to their MICs. Synergism can occur when two various antibacterial agents, each with non-overlapping mechanisms of action, are combined with each other [30]. Therefore, the authors suggest that the antimicrobial effects could be strengthened using synergistic effects of combined organic acid with rAGAAN. While the precise process; by which, combination of rAGAAN with organic acid created synergistic effects is still unknown, studies have demonstrated that the cell membrane of bacteria is a shared target for the antibacterial effects of various antimicrobial peptides. Additionally, these peptides include an affinity for bacterial cellular components, including DNA [31]. In contrast, it is suggested that organic acids can delay absorption of nutrients and disrupt flow of electrons, leading to decreases in ATP production [32]. This various mechanism of action enables swift eradication of bacteria.

3.3 Kinetics of inactivation

Acetic acid was chosen for the study because it included stronger antimicrobial effects than that formic acid with rAGAAN did. Growth inhibition kinetics of rAGAAN, acetic acid and their combination on the logarithmic phase of the pathogenic bacteria are illustrated in Figure 1. When the peptide rAGAAN was mixed with acetic acid at the FIC, there was no noticeable alteration in OD for either of the bacterial strains during 5 h. This indicated that the bacterial growth was entirely suppressed. The combination demonstrated significant inhibitory effects, greater than that of the individual antimicrobial agent and control group. The combination exhibited the capacity to inhibit proliferation of S. aureus ATCC 6538 and E. coli ATCC 8739 at various concentrations within a few hours of exposure. Upon analyzing each treatment individually, it became clear that progressive decreases occured in OD measurements as time progressed. Nevertheless, use of rAGAAN with acetic acid led to further pronounced decreases in the turbidity level of the culture.

3.4 β-Galactosidase assay

To clarify the mechanism; by which, the combination acted, membrane permeability assay was carried out. This experiment used E. coli that was cultured in media containing lactose broth, which stimulated the synthesis of β-galactosidase. The β-galactosidase is an endogenous enzyme synthesized by the lac operon in bacteria. Release of this enzyme depends on disruption of the cell membrane. Release of the β-galactosidase enzyme from the disrupted cytoplasmic membrane was detected within 10 min of incubation with rAGAAN alone. In addition, cell membrane was destabilized by a combination of rAGAAN with acetic acid at 1× FICI, 2× FICI and 3× FICI, as shown in Figure 2.

Findings showed that the presence of rAGAAN, independently and in combination with acetic acid, could result in permeability of the cell membrane of E. coli. How-ever, acetic acid alone did not demonstrate effects on perme-ability of the membrane. Increasing OD measurements over time were directly linked to the rate of O-nitrophenol prod-uction from the breakdown of ONPG. The current results were similar to those of Yuan et al. [33], who observed increases in OD due to the degradation of ONPG when Larimichthys crocea myosin heavy chain protein-derived peptide was combined with low-intensity ultra-sound. Cell membrane disruption might lead to releases of intracellular components [34].

3.5 Hemolysis assay

Potential cytotoxicity of the chemical combination on human RBCs was assessed. Results of the hemolytic assay are present in Figure 3. The experimental group supernatant included clarity and transparency, which sharply contrasted to that the positive control group supernatant did. Further-more, no substantial fluctuation was recorded in absorbance of the experimental groups. This demonstrated that combin-ation of acetic acid and rAGAAN did not include any adverse effects on RBCs. However, absorbance of acetic acid alone resulted in approximately 50% hemolysis of the RBCs presented at high concentrations. Results suggested that the two antibacterial agents could effectively be combined as harmless food additives to combat pathogens.

 

3.6 rAGAAN-acetic acid against chicken meat spoilage

Results of the experiment are shown in Table 3 and Figure 4. Use of rAGAAN and acetic acid, either separately or in combination, led to significant suppressions of the E. coli growth. Inhibition was observed at various durations of exposure, in contrast to the control group (Table 3). At the beginning of the experiment (Day 0) after exposure to DW for 1 h, the control group showed decreases in the cell population to a value of 6.06 log 10 cfu.g-1. Significant decreases (p = 0.05) were observed in the bacterial count after individual treatment with rAGAAN and acetic acid (4.87 and 5.01 cfu.g-1, respectively). Similarly, when the combination therapy was administered at concentrations of 1×, 2× and 3×, the resulting bacterial counts were 4.85, 4.82 and 4.81 cfu.g-1, respectively. Significant differences in decreases were reported when comparing the control group to the groups that received rAGAAN treatment alone and the groups that received combination treatments at a three-fold fractional inhibitory concentration index as the duration of treatment increased. On Day 1 of the experiment, statistically significant decreases were seen in values of the microorganisms. More precisely, rAGAAN alone and its combination resulted in decreases of 1.39 and 1.40 log 10 cfu.g-1, respectively.

 

On Day 2, the 3× FICI combination group showed statistically significant decreases of 1.53 log 10 cfu.g-1, compared to the control group (p = 0.05). Furthermore, significant decreases of 1.63 log 10 cfu.g-1 were reported on Day 3, compared to the control group. Results of this study demonstrated that use of rAGAAN and acetic acid included combined antibacterial effects on E. coli in meat samples stored at 37 °C for 3 d. The synergistic effect was detected as superior to the antibacterial effects of rAGAAN when used separately. Results supported changes in the color of the meat. The transformation is documented through the alteration in color of the meat (Figure 4). The control group demonstrated a significant color change and included an unpleasant smell. This might be attributed to the prolif-eration of microbial organisms. Katiyo et al. [35] reported strong correlations between the odor and growth of microorganisms in chicken legs. The putrid smell of spoiled meat might be due to the existence of various compounds such as sulfur compounds, carbonyls, ketones, diamines and alcohols [36].

  1. Conclusion

This study provided evidence on the synergistic effects of combining rAGAAN antimicrobial peptides with organic acids to inhibit growth of two prevalent foodborne pathogens of S. aureus and E. coli. Significantly, this integr-ated approach created inhibitory effects at decreased con-centrations, compared to separate uses of these substances. The study revealed that rAGAAN included the highest beneficial synergy when combined with acetic acid. Simultaneous administration of rAGAAN and acetic acid caused disruption of the bacterial cell membrane without causing detectable harms to mammalian RBCs. Further-more, implementation of multiple treatments led to decre-ases in the presence of microorganisms in chicken meats after 3 d, compared to the group with no treatments. The study results can be used as secure economically feasible alternatives for the preservation of chicken meats. While the current study assessed two pathogens, further studies are necessary to investigate effects of the chemical combi-nations on a wider range of microorganisms as well as assessing precise mechanisms of the synergistic intera-ctions.

  1. Acknowledgements

This study was supported by research funds from Petchra Pra Jom Klao Research Scholarship (contract no. 74/2563) and Faculty of Science, King Mongkut’s University of Technology Thonburi.

  1. Conflict of Interest

The authors declare no conflict of interest.

  1. Authors Contributions

Investigation, writing-original draft, data curation and formal analysis, N.U.J.; formal analysis, validation, Y.S.A.; Data curation, formal analysis, N.R.; project administration and supervision, T.R.; methodology, supervision, W.S.; project administration and supervision, P.P.; supervision, conceptualization, funding acquisition, resources, methodology, N.J.

References

  1. WHO (World Health Organization). WHO estimates of the global burden of foodborne diseases. 2015.

https://iris.who.int/bitstream/handle/10665/199350/9789241565165_eng.pdf?sequence=1

  1. Krepker M, Shemesh R, Danin Poleg Y, Kashi Y, Vaxman A, Segal E. Active food packaging films with synergistic antimicrobial activity. Food Control. 2017; 76:117-126.

https://doi.org/10.1016/j.foodcont.2017.01.014.

  1. Bohrer BM. Review: Nutrient density and nutritional value of meat products and non-meat foods high in protein. Trends Food Sci Technol. 2017; 65: 103-112.

https://doi.org/10.1016/j.tifs.2017.04.016.

  1. Zhou GH, Xu XL, Liu Y. Preservation technologies for fresh meat - A review. Meat Sci. 2010; 86: 119-28.

https://doi.org/10.1016/j.meatsci.2010.04.033.          

  1. Xin WG, Wu G, Ying JP, Xiang YZ, Jiang YH, Deng XY, Lin LB, Zhang QL. Antibacterial activity and mechanism of action of bacteriocin LFX01 against Staphylococcus aureus and Escherichia coli and its application on pork model. Meat Sci. 2023; 196.

https://doi.org/10.1016/j.meatsci.2022.109045.

  1. Raftari M, Jalilian FA, Abdulamir AS, Son R, Sekawi Z, Fatimah AB. Effect of organic acids on Escherichia coli O157:H7 and Staphylococcus aureus contaminated meat. Open Microbiol J. 2009; 3: 121-127.

https://doi.org/10.2174/1874285800903010121

  1. Diyantoro, Wardhana DK. Risk factors for bacterial contamination of bovine meat during slaughter in ten Indonesian abattoirs. Vet Med Int. 2019; 2019: 2707064.

https://doi.org/10.1155/2019/2707064.

  1. Pal M, Ketchakmadze D, Durglishvili N, Ketchakmadze I. Staphylococcus Aureus: A major pathogen of food poisoning. J Nutr Food Processing. 2022; 5: 01-3.

https://doi.org/10.31579/2637-8914/074.

  1. Sun R, Li Y, Du T, Qi Y. Recent advances in integrated dual-mode optical sensors for food safety detection. Trends Food Sci Technol. 2023; 135: 14-31.

https://doi.org/10.1016/j.tifs.2023.03.013.

  1. Jackson KA, Gokhale RH, Nadle J, Ray SM, Dumyati G, Schaffner W, Ham DC, Magill SS, Lynfield R, See I. Public Health Importance of Invasive Methicillin-sensitive Staphylococcus aureus Infections: Surveillance in 8 US Counties, 2016. Clin Infect Dis 2020; 70:1021-1028.

https://doi.org/10.1093/cid/ciz323.

  1. Yang SC, Lin CH, Aljuffali IA, Fang JY. Current pathogenic Escherichia coli foodborne outbreak cases and therapy development. Arch Microbiol. 2017; 199:811-825.

https://doi.org/10.1007/s00203-017-1393-y.

  1. Hajati H. Application of organic acids in poultry nutrition. Int J Avian & Wildlife Biol. 2018; 3: 324-329.

https://doi.org/10.15406/ijawb.2018.03.00114.

  1. Pisoschi AM, Pop A, Georgescu C, Turcuş V, Olah NK, Mathe E. An overview of natural antimicrobials role in food. Eur J Med Chem. 2018; 143: 922-935.

https://doi.org/10.1016/j.ejmech.2017.11.095.

  1. Ma B, Fang C, Lu L, Wang M, Xue X, Zhou Y, Li M, Hu Y, Luo X, Hou Z. The antimicrobial peptide thanatin disrupts the bacterial outer membrane and inactivates the NDM-1 metallo-β-lactamase. Nat Commun. 2019; 10(1): 3517.

https://doi.org/10.1038/s41467-019-11503-3.

  1. Monteiro JMC, Oliveira MD, Dias RS, Nacif-Marçal L, Feio RN, Ferreira SO, Oliveira LL, Silva CC, Paula SO. The antimicrobial peptide HS-1 inhibits dengue virus infection. 2018; 514: 79-87.

https://doi.org/10.1016/j.virol.2017.11.009.

  1. Heymich ML, Friedlein U, Trollmann M, Schwaiger K, Böckmann RA, Pischetsrieder M. Generation of antimicrobial peptides Leg1 and Leg2 from chickpea storage protein, active against food spoilage bacteria and foodborne pathogens. Food Chem 2021; 347. 128917

https://doi.org/10.1016/j.foodchem.2020.128917.

  1. Dong B, Lin Y, Wang J, Du W, Sun C, Fu S, Wu T. Antibacterial activity of antimicrobial peptide gcDefb1 against foodborne pathogenic bacteria and its application in pork storage. Food Sci Biotechnol. 2022; 31: 597-605.

https://doi.org/10.1007/s10068-022-01060-9.

  1. Zhao G, Kempen PJ, Zheng T, Jakobsen TH, Zhao S, Gu L, Solem C, Jensen PR. Synergistic bactericidal effect of nisin and phytic acid against Escherichia coli O157:H7. Food Control. 2023; 144.

https://doi.org/10.1016/j.foodcont.2022.109324.

  1. Luo X, Song Y, Cao Z, Qin Z, Dessie W, He N, Wang Z, Tan Y. Evaluation of the antimicrobial activities and mechanisms of synthetic antimicrobial peptide against food-borne pathogens. Food Biosci. 2022; 49.

https://doi.org/10.1016/j.fbio.2022.101903.

  1. Ajingi YS, Rukying N, Jiddah NU, Koga Y, Jongruja N. Cloning, recombinant expression, purification and functional characterization of AGAAN antibacterial peptide. 3 Biotech 2023; 13(3). 88.

https://doi.org/10.1007/s13205-023-03512-3.

  1. Chatupheeraphat C, Peamchai J, Luk-in S, Eiamphungporn W. Synergistic effect and antibiofilm activity of the antimicrobial peptide K11 with conventional antibiotics against multidrug-resistant and extensively drug-resistant Klebsiella pneumo-niae. Front Cell Infect Microbiol. 2023; 13.

https://doi.org/10.3389/fcimb.2023.1153868.

  1. World Health Organization Organisation mondiale de la Santé The world health report 1998 Life in the 21st century: a vision for all. 1998.

https://apps.who.int/gb/archive/pdf_files/WHA51/ea3.pdf

  1. Hossain F, Follett P, Dang Vu K, Harich M, Salmieri S, Lacroix M. Evidence for synergistic activity of plant-derived essential oils against fungal pathogens of food. Food Microbiol 2016; 53: 24-30.

https://doi.org/10.1016/j.fm.2015.08.006.

  1. Taniguchi M, Ochiai A, Takahashi K, Nakamichi S ichi, Nomoto T, Saitoh E, Kato T, Tanaka T. Antimicrobial activity against Porphyromonas gingivalis and mechanism of action of the cationic octadecapeptide AmyI-1-18 and its amino acid-substituted analogs. J Biosci Bioeng. 2016; 122: 652-659.

https://doi.org/10.1016/j.jbiosc.2016.05.008.

  1. Ajingi YS, Rodpan S, Usman JN, Koga Y, Jongruja N. Synergistic effect of nisin with acetic and propionic acids inactivates Bacillus subtilis on meat and potato. Biocatal Agric Biotechnol. 2022; 41.

https://doi.org/10.1016/j.bcab.2022.102317.

  1. Pangprasit N, Srithanasuwan A, Suriyasathaporn W, Pikul-kaew S, Bernard JK, Chaisri W. Antibacterial activities of acetic acid against major and minor pathogens isolated from mastitis in dairy cows. 2020; 9:1-6.

https://doi.org/10.3390/pathogens9110961.

  1. Fraise AP, Wilkinson MAC, Bradley CR, Oppenheim B, Moiemen N. The antibacterial activity and stability of acetic acid. J Hosp Infect. 2013; 84: 329-331.

https://doi.org/10.1016/j.jhin.2013.05.001.

  1. Gómez-García M, Sol C, De Nova PJG, Puyalto M, Mesas L, Puente H, Mencía-Ares Ó, Miranda R, Arguello H, Rubio P, Carvajal A. Antimicrobial activity of a selection of organic acids, their salts and essential oils against swine enteropath-ogenic bacteria. Porcin Health Manag. 2019; 5: 32.

https://doi.org/10.1186/s40813-019-0139-4.

  1. Halstead FD, Rauf M, Moiemen NS, Bamford A, Wearn CM, Fraise AP, Lund PA, Oppenheim BA, Webber MA. The antibacterial activity of acetic acid against biofilm-producing pathogens of relevance to burns patients. PLoS One. 2015; 10(9).

https://doi.org/10.1371/journal.pone.0136190.

  1. Peh E, Kittler S, Reich F, Kehrenberg C. Antimicrobial activity of organic acids against Campylobacter spp. And development of combinations-A synergistic effect? PLoS One 2020; 15(9).

https://doi.org/10.1371/journal.pone.0239312.

  1. Li J, Koh JJ, Liu S, Lakshminarayanan R, Verma CS, Beuer-man RW. Membrane active antimicrobial peptides: Translat-ing mechanistic insights to design. Front Neurosci. 2017; 11: 73.

https://doi.org/10.3389/fnins.2017.00073.

  1. McDermott A, Whyte P, Brunton N, Lyng J, Fagan J, Bolton DJ. The effect of organic acid and sodium chloride dips on the shelf-life of refrigerated Irish brown crab (Cancer pagurus) meat. 2018; 98: 141-147.

https://doi.org/10.1016/j.lwt.2018.08.039.

  1. Yuan Z, Aweya JJ, Li J, Wang Z, Huang S, Zheng M, Shi L, Deng S, Yang S. Synergistic antibacterial effects of low-intensity ultrasound and peptide LCMHC against Staphyl-ococcus aureus. Int J Food Microbiol. 2022; 373. 109713

https://doi.org/10.1016/j.ijfoodmicro.2022.109713.

  1. Bajpai VK, Park IW, Khan I, Alshammari FH, Kumar P, Chen L, Na M, Huh YS, Han YK, Shukla S. (−)-Tetrahydro-berberrubine∙acetate accelerates antioxidant potential and inhibits food associated Bacillus cereus in rice. Food Chem. 2021; 339.

https://doi.org/10.1016/j.foodchem.2020.127902.

  1. Katiyo W, de Kock HL, Coorey R, Buys EM. Sensory implications of chicken meat spoilage in relation to microbial and physicochemical characteristics during refrigerated storage. LWT 2020; 128.

https://doi.org/10.1016/j.lwt.2020.109468.

  1. Casaburi A, Piombino P, Nychas GJ, Villani F, Ercolini D. Bacterial populations and the volatilome associated to meat spoilage. Food Microbiol. 2015; 45(Pt. A):83-102.

Background and Objective: Komak beans include high nutritional values, making them promising raw materials for alternative food sources such as tempe. Because the beans are hard, they need soaking in water for 72 h with the water change every 12 h. Soybeans only need soaking for 24 h without changing the water during tempe processing. In this study, pressure cooking was used for Komak beans prior to soaking and a starter culture of Lactiplantibacillus plantarum subsp. plantarum WGK4 was added to the soaking water to decrease the quantity of water soaking and soaking time.

Material and Methods: Komak beans were pretreated by pressure-cooking for various times and texture and anti-nutritional factors were assessed. The selected pressure-cooked Komak beans were soaked in water and inoculated with Lactiplantibacillus plantarum subsp. plantarum WGK4. The pH, titratable acidity, soluble protein and minerals were assessed in the soaked water and Komak beans. The soaking water was assessed for viable lactic acid bacteria and anti-nutritional and volatile compounds were assessed in the soaked Komak beans. Mold fermentation was carried out by adding 0.2% (w.w-1) tempe starter culture to the drained Komak beans and incubating for 48 h at room temperature. 

Results and Conclusion: Dehulled Komak beans that were pressure-cooked for 15 min included a hardness value of 34.47 N, which was close to the hardness of boiled soybeans in traditional tempe preparing. Pressure-cooking Komak beans significantly decreased anti-nutritional factors. Addition of Lactiplantibacillus plantarum subsp. plantarum WGK4 during the 24-h soaking step decreased pH of Komak bean from 6.7 to 4.5. Decreases in tannin concentration was observed. Volatile compounds responsible for the beany flavor were not detected in the Komak beans at the end of the soaking. Pressure-cooking and addition of Lactiplantibacillus plantarum subsp. plantarum WGK4 significantly shortened the soaking time and decreased water needed for Komak Tempe processing. This process provides tempe as an affordable plant-based protein alternative.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Komak bean (Lablab purpureus (L.) Sweet) is a legume that is widely cultivated in arid areas such as Lombok Island, West Nusa Tenggara, and Indonesia [1]. Commonly cultivated as a backyard crop, intercrop or monoculture crop, Komak can be harvested four months after planting [2], allowing for year-round use and ensuring supply availab-ility. Komak beans have traditionally been consumed as vegetables and snacks. These beans are valued for their nutritional composition, characterized by moderate protein, high carbohydrate and low fat contents [3]. Availability and rich nutritional contents of these beans make them promising alternative food sources, especially as plant-based protein options such as tempe. Tempe, a traditional Indonesian fermented food, is processed by fermentation of soybeans with Rhizopus spp.

Soybeans are typically used as ingredients in tempe production. However, other beans such as jack beans [4], velvet beans [5] and other common beans [6] can be used. Time needed to prepare tempe varies, especially in the soaking step, depending on characteristics of the beans. Soybeans only need 24 h of soaking to soften the beans in tempe processing [7] but jack beans need 48 h of soaking with water changing every 12 h [4] and velvet beans need a 96-h soaking time with water changing every 12 h [5]. A preliminary study showed that Komak beans could be used as raw materials for Tempe; however, they need 72 h of soaking, with water changing every 12 h. Komak beans are hard with larger bean size, compared to soybeans [7]; however, Komak bean size is smaller than jack [8] and velvet [9] bean sizes. Therefore, Komak Tempe-preparing needs a longer soaking time and consumes six times more water quantity. Tempe production needs a large quantity of water for soaking, changing water and boiling, which hence generates wastewater containing components that can pollute the environment. Therefore, it is necessary to shorten soaking time and decrease water use while creating conditions appropriate for mold fermentation.

Studies have used pressure-cooking methods to speed up softening of beans during soaking. High pressure and uniform heat distribution improved softening of the beans. Time needed for softening can vary depending on size and hardness of the beans [10]. For example, pressure-cooking for 15 min at 110 °C effectively softens common beans [11] and a similar time at 120 °C is appropriate for barlotto beans, chickpeas and kidney beans [12]. Pressure-cooked Komak beans may decrease soaking time and provide a soft texture appropriate for acid fermentation. In soaking, natural acidification occurs due to spontaneous lactic acid bacteria (LAB), decreasing pH of the beans to 4–5, which can inhibit the growth of contaminant microorganisms and pathogenic bacteria [13].

The LAB are addressed for their significant roles in bean soaking of Tempe production. Studies by [14,15] have identified LAB at various stages of soybean tempe production. Moreover, LAB strains isolated at various stages of Tempe processing exhibit antimicrobial activities [16]. The LAB decrease anti-nutritional factors such as phytic acid, tannin [17] and beany flavor [18]. In studies, LAB were added when beans were soaking. These bacteria include Lactobacillusplantarum DSM 20174 in common beans [6] and Lactobacillus fermentum HPBD2 in soybeans [19]. This addition could decrease the pH value, shorten the soaking time and inhibit unwanted bacteria such as Enterobacteriaceae. The LAB of Lactiplantibacillus plantarum subsp. plantarum WGK4 isolated from the soaking water of legumes can grow and produce acids in jack bean [15] and black soy [20] milks. Research regarding the combination of pressure-cooking and LAB addition during the soaking stage prior to mold fermentation have not been carried out. Therefore, the major aim of this study was to investigate effects of pressure-cooking time of Komak beans prior to soaking and addition of Lactiplantibacillus  plantarum subsp. plantarum WGK4 starter culture to soaking water in Tempe processing on decrease of soaking-water quantity and soaking time.

  1. Materials and Methods

2.1. Materials

Cream-colored Komak jamak putek (Lablab purpureus (L.) Sweet) was received from farmers in the North Lombok District of Lombok Island, Indonesia. Samples were collected during a dry season (July–September), 2020. The L. plantarum subsp. plantarum WGK4 (WGK4) was isolated from water soaked in red lima beans in Tempe production [15],  Biotechnology Laboratory, Department of Food and Agricultural Product Technology, Faculty of Agricultural Technology, Universitas Gadjah Mada, Yogyakarta, Indonesia. A commercial Tempe starter (containing R. oligosporus) (Raprima, Bandung, Indonesia) was purchased from a local market in Yogyakarta, Indonesia. De Mann, Rogosa and Sharpe (MRS) media were supplied by Merck, Darmstadt, Germany. All chemical reagents were purchased from Sigma-Aldrich, USA.

2.2. Preparation of Starter Culture

The starter culture was prepared as previously described by Yudianti et al. [15]. Culture stock was stored at -20 °C in a sterile solution containing 1:1 ratio of 20% w.v-1 sucrose and 10% w.v-1 skim milk. Working culture was prepared by incubating the culture in MRS broth at 37 °C for 24 h, then inoculating it into MRS deep tube agar. This was incubated at 37 °C for 24 h and stored at 4 °C. Starter culture was activated by inoculation of the working culture into MRS broth and incubation at 37 °C for 24 h twice. Cell pellets were harvested by centrifugation at 2000 rpm for 10 min (Thermo-Fischer Scientific, Germany) and washing twice with sterile saline water. The LAB starter culture was quantified and recorded as CFU.ml-1.

2.3. Preparation of Komak Beans and Pressure-cooking Treatments

Komak beans were peeled using peeler machine (Yamamoto SY 150, Medan, Indonesia). Beans were rinsed and soaked in distilled water (DW) (1:5 w.v-1) for 6 h at ambient temperature. After discarding the soaking water, beans were washed with DW. Beans were transferred into an Erlenmeyer flask and filled with DW (1:2 w.v-1). Then, flask was subjected to pressure-cooking at 110 °C for 10, 15 and 20 min using portable pressure cooker (All American, Wisconsin, and USA). Raw, soaked dehulled and pressure-cooked soaked beans were assessed for hardness. These samples were freeze-dried (Labconco, Kansas City, USA) and transferred into a freezer at -20 °C until analysis of phytic acid, trypsin inhibitor (TI), tannin and volatile compounds.

2.4. Acid Fermentation of Komak Beans with Addition of Lactiplantibacillus plantarum subsp. plantarum WGK4

A starter culture of WGK4 was added to the selected pressure-cooked Komak beans with the soaking water. The primary LAB concentration was 10⁶ CFU.ml-1. Acid ferme-ntation was carried out at room temperature (RT) for 24 h. Soaked pressure-cooked Komak beans without addition of LAB starter culture were used as control. Every 2 h, samples of soaking water and soaked Komak beans were collected and assessed for pH and titratable acidity. Soaking water sample was assessed for viable cells as well. When pH of the Komak beans reached to 5.0 and 4.5, soaking water was analyzed for soluble proteins and minerals: potassium, magnesium, phosphorus, iron and calcium. Soaked beans were freeze-dried and stored at -20 °C until analysis of soluble proteins, minerals, anti-nutritional compounds and volatile compounds.

2.5. Komak Tempe Fermentation

Komak beans were added to a starter culture (WGK4) and soaked to achieve pH appropriate for mold fermen-tation. Beans were drained and inoculated with a comercial Tempe starter (0.2% w.w-1). Tempe fermentation was carried out for 48 h at RT using perforated plastic bags. Komak Tempe was freeze-dried and stored at -20 °C until analysis of soluble protein, phytic acid, TI and tannin.

2.6. Hardness Assessment

Hardness of the raw, soaked dehulled and pressure-cooked beans was assessed using universal testing machine (Z0.5, Zwick/Roell, and Germany) [9]. Assessment was carried out at a speed of 10 mm.min-1 with pre-load of 0.01 N. Hardness was assessed as the compression force used to deform the beans. Force was assessed in Newtons (N).

2.7. Viable Lactic Acid Bacteria Count

Viable LAB count was assessed based on a procedure described by Yudianti et al. [15]. Viable cells in soaking water were assessed using serial dilution and pour-plate methods as well as MRS agar added with CaCO3 and incubated at 37 °C for 48 h. After incubation, colonies on plates were calculated and reported as log CFU.mL-1.

2.8. pH and Titratable Acidity

The pH of the soaking water and beans was assessed using pH meter (FiveEasy F20, Mettler-Toledo, Switzer-land). Approximately 5 g of the crushed bean sample were mixed with DW (1:1). Titratable acidity analysis was carried out by titration of 5 ml of soaking water or 5 g of crushed bean mixed with DW (1:1) and 0.1 N NaOH using phenolphthalein (PP) as indicator [21].

2.9. Analysis of Minerals Contents

Mineral contents (K, Mg, P, Fe and Ca) were assessed using ICP-OES (Agilent Technologies 700 Series ICP-OES, Santa Clara, CA, USA) and assessed based on AOAC 2011.14 [21]. Nearly 0.5 ml of soaking water and 0.5 g of freeze-dried sample were digested and mineralized by adding 10 ml of concentrated HNO3, followed by 15 min of heating at 150 °C using microwave oven. Digested sample was set to reach RT and then an internal standard containing 100 mg.l-1 yttrium was added to the sample, followed by addition of DW to reach 50 ml of the final solution. This was filtered before ICP-OES analysis, using filter papers.

2.10. Analysis of Soluble Protein

Soluble protein assessment in soaking water and soaked Komak beans was carried out using Lowry method [22]. Freeze-dried sample (1 g) was added to 10 ml of DW and mixed for 30 min using water bath shaker. After centrifuge-ation at 3000 rpm for 15 min, supernatant (1 ml) and soaking water (1 ml) were mixed with 0.9 ml of Lowry A. Then, mixture was incubated using water bath shaker. Incubation time included 10 min at 50 °C. Cooled mixture was added with 0.1 ml of Lowry B and left for 10 min at RT. Then, 3 ml of Lowry C were added to the mixture and incubated at 50 °C for 10 min using water bath shaker. Mixture was cooled down to RT and absorbance was recorded at 650 nm immediately. Bovine serum albumin was prepared for the standard curve plotting.

2.11. Analysis of Phytic Acid 

Phytic acid content was assessed using a method described by Fitriani et al. [23]. Freeze-dried sample (0.1 g) was mixed with 20 ml of 0.5 M HNO₃ and incubated for 4 h at RT using water bath shaker. Then, mixture was filtered and 1 ml of the resulting extract was mixed with 1 ml of 0.005 M FeCl₃.6H₂O and 0.4 ml of DW followed by heating for 20 min in boiling water (100 °C). After cooling down, mixture was mixed with 5 ml of N-amyl alcohol and 0.1 ml of 0.1 M ammonium thiocyanate and centrifuged at 3000 rpm for 10 min. Then, absorbance was assessed at 495 nm. To generate phytic acid standard curve, a mixture of Na-phytate and HNO₃ solution was used.

2.12. Analysis of Tannin

Tannin concentration was assessed using a procedure described by Fitriani et al. [23]. A freeze-dried sample of 0.31 g was mixed with 62.5 ml of DW and boiled at 100 °C for 2 h. After cooling down, solution was filtered through Whatman filter papers no. 1. Then, 0.5 ml of Folin-Ciocalteu reagent and 2 ml of 20% Na₂CO₃ were added to 1 ml solution. Mixture was incubated at RT for 30 min. Absorbance was read at 748 nm.

2.13. Analysis of Trypsin Inhibitor

The TI was analyzed as previously described by Fitriani et al. [23]. The TI analysis was carried out by preparing TI extract, a substrate (BAPNA solution) and trypsin solution. The TI extract was prepared by dissolving 1 g of freeze-dried sample in 50 ml of 0.01 M NaOH. Mixture was agitated for 3 h at RT using water bath shaker, followed by centrifugation at 3500 rpm for 10 min. Substrate was prepared by dissolving 40 mg of BAPNA in 100 ml of 0.05 M tris-buffer (pH 8.2) in 1 ml of DMSO and stored at 37 °C. Substrate was prepared freshly before assessment. Trypsin solution was prepared by dissolving 4 mg of trypsin in 200 ml of 0.001 M HCl and stored at 4 °C. Generally, TI analysis initiated with the preparation of the control and sample solutions. Control solution was prepared by mixing 2 ml of DW, 5 ml of BAPNA and 2 ml of trypsin solution. Sample solution was prepared using a similar procedure but with addition of the extract. Solutions were incubated at 37 °C for 10 min using water bath shaker. Following incubation, 1 ml of 30% acetic acid was added to terminate the reaction and the mixture was centrifuged for 10 min. Absorbance measurement was carried out at 410 nm using UV/visible spectrophotometer. The TI formula was as Eq. 1:

                                                                                           Eq. 1

2.14. Analysis of Volatile Compounds

Headspace SPME/GC-MS was used to analyze volatile compounds of freeze-dried samples released in the headspace. Briefly, 5 g of freeze-dried sample were transferred into a headspace vial (22 ml) with polytetrafluorethylene-silicone septa. A divinylbenzene/ carboxen/polydimethylsiloxane (DVB/ CAR/PDMS) fiber was inserted into the vial and incubated at 80 °C for 45 min using water bath. Fiber was immediately injected into the injector port of the GC-MS for 5 min of desorption at 250 °C. Agilent 7890A GC and Agilent 5975C XL EI/CI MS (Santa Clara, CA, USA) were the instruments of analysis. The capillary column included DB-Wax (30 × 250 × 0.25 m). The oven temperature was initially set to 40 °C, increased by 5 °C.min-1 to 120 °C, then increased by 9 °C.min-1 to 240 °C and set for 5 min. Helium was used as carrier gas at a flow rate of 1 ml.min-1. The quadrupole and ion source temperatures were set at 150 and 250 °C, respectively. The volatile compounds were identified based on their mass spectra and the NIST 14.0 database. The linear index was calculated using retention data from the standard alkane series (C9-C31). Relative peak area (%) was estimated by comparing the peak area of each compound with the peak area of all compounds [24].

2.15. Statistical Analysis

A completely randomized experimental design with three replications was used in this study. Data were analyzed using one-way ANOVA followed by Duncan's multiple range test when significant differences were present (p < 0.05). Software used for the analysis was SPSS software v.25 (SPSS, Chicago, USA). Results are presen as mean and standard deviation (SD).

  1. Results and Discussion

3.1. Pressure cooking treatment

Komak beans were pressure cooked for various quantity of time and the hardness and anti-nutritional contents were assessed. This study demonstrated that pressure-cooking treatment significantly affected hardness (p < 0.05). Findings showed that raw Komak beans included the highest hardness (341.93 ± 0.86 N). Dehulling followed by soaking for 6 h (RBPS) significantly decreased the hardness to 84.29 N ±0.73 (Table 1). In soaking, dehulled beans absorbed water, decreasing hardness and increasing swelling of the beans, which might decrease the cooking time [10].

Pressure-cooking of the beans further decreased their hardness. The longer the pressure-cooking time, the softer the Komak beans. This softening was associated to structural changes in the beans. Breakdown of cell walls in the beans resulted in the release of pectin and protein middle lamella, which contributed to binding and firmness of the beans [11]. Dehulled Komak beans that were pressure-cooked for 15 min included a hardness value of 34.47 N ±0.51, which was similar to the value of the hardness of boiled soybeans from traditional Tempe (34 N).

Phytic acid, trypsin inhibitor and tannin content in raw Komak beans were 11.77 mg.g-1 ±0.97, 2.14 TIU.mg-1 ±0.02 and 11.94 mg.g-1 ±0.23, respectively (Table 2). Dehulling and soaking of komak beans significantly decreased the trypsin inhibitor and tannin content (p < 0.05) but did not significantly decrease the phytic acid content (p > 0.05). Pressure-cooking treatment significantly decreased the anti-nutrient factors in this study. Phytic acid concentration of the pressure-cooked dehulled komak beans for 10, 15 and 20 min decreased by 47.1-51%, compared to dehulled beans (RBPS). Phytic acid could bind to minerals such as calcium, copper, zinc and iron, delaying their absorption.

It has been reported that soaking and pressure-cooking of soaked kidney beans decreased phytic acid contents by 19 and 62%, respectively [25]. The higher phytic acid decrease in kidney beans could be attributed to longer soaking time and higher temperature during pressure-cooking. Soaking time for kidney beans was 12 h and pressure-cooking temperature and time were 121 °C and 30 min, respectively [25]. Trypsin inhibitor content of Komak beans was 2.14 TIU.mg-1 ±0.02 and trypsin inhibitor loss during soaking was 3.7%. However, a high decrease rate in trypsin inhibitor was detected in the pressure-cooking treatment (91.1-93.9%). High temperature and pressure could disrupt covalent and non-covalent bonds of proteins, resulting in inactivation of trypsin inhibitor activity [26]. Compared to raw beans, dehulled soaked beans decreased the tannin content by 7.8%, whereas pressure-cooked beans decreased the tannin content by 41.6-64.8% for 10-20 min. Decreases in tannin concentration during the soaking process might be caused by leaking of its compounds into the soaking water, while the pressure-cooking process might decrease the tannin content by thermal degradation of these compounds [27]. Decreases in tannin concentration due to pressure cooking of presoaked and soaked kidney beans and cowpeas have been reported as well [25,27]. This suggests that pressure-cooking Komak beans for 15 min can decrease the hardness similar to that of soaked soybeans and significantly decrease phytic acid, trypsin inhibitor and tannin contents. The pressure-cooking method can be used to soften beans and decrease anti-nutrient substances prior to the soaking step.   

3.2. Acid Fermentation of Komak Beans with Addition of Lactiplantibacillus plantarum subsp. plantarum WGK4

3.2.1. Viable cells, pH and Total Titratable Acid of Soaking Water and Komak Beans

Acid fermentation of Komak beans by pressure-cooking treatment for 15 min was carried out by the addition of WGK4 starter culture, followed by 24 h of incubation at RT. The soaking water used included water from the pressure-cooking step. Acid fermentation without starter culture addition was used as control (Figure 1A). No viable LAB were present during the soaking time. A possible explanation for this might be that natural LAB from the raw materials and soaking water were killed by heating during the pressure-cooking. Thus, titratable acidity of the soaking water and Komak beans in the control did not increase and pH of soaking water and Komak beans was approximately similar during soaking.

Acid fermentation supplemented with WGK4 starter culture (Figure 1B) showed increased LAB growth from 6.2 to 9.5 log CFU.ml-1 by the end of the soaking time. Viable LAB count increased significantly for 12 h and then was relatively constant until the completion of soaking. The LAB needed carbon and nitrogen sources, vitamins and minerals for their growth and metabolic activities [28]. Fermentable sugars in soaked beans and soaking water were used by LAB and metabolized to compounds, especially lactic acid, increasing titratable acidity and decreasing pH of the soaked beans and soaking water. Sucrose was the most common sugar in Komak beans.

The beans also contained stachyose (2.77%) and raffinose (0.45%) [29]. The WGK4 has been reported to use fructose, glucose, sucrose and raffinose for growth [15, 20]. According to [30], L. plantarum C6 used stachyose and raffinose to grow through the production of α-galactosidase. 

In this study, WGK4 showed a good growth rate during fermentation of the soaked Komak bean. After 24 h of ferm-entation, growth of WGK4 reached to 9.5 log CFU.ml-1. In addition, black soymilk fermentation using WGK4 at 37 °C increased the cell count from 6.4 to 9.1 log CFU.ml-1 [20]. This indicated that WGK4 could use nutrients in black soymilk for its growth. Kitum et al. [17] detected that addition of L. plantarum BFE 5092 to soaked kidney beans increased the cell count by 2 log cycles from 6.5 to 8.5 log CFU.ml-1 following fermentation for 24 h. The WGK4 growth during acid fermentation of Komak beans increased by more than 3 log cycles. It is possible that during pressure-cooking prior to soaking, nutrients from the Komak beans needed for the growth of WGK4 were released into the soaking water. Tables 3 and 4 show increases in soluble protein and minerals in the soaking water after pressure-cooking.

3.2.2. Soluble Protein and Mineral of Soaking Water and Komak Beans

After pressure-cooking treatment for 15 min, protein contents in water and Komak beans were 0.28% ±0.03 and 4.16% ±0.05, respectively (Table 3). Pressure-cooking increased the soluble protein of Komak beans, compared to raw beans. Total and soluble s of the Komak beans were 26 and 1.67%, respectively. Water used for the pressure-cooking was used for acid fermentation without changes or addition of fresh water.

During soaking, soluble protein in the Komak beans decreased, while soluble protein in the soaked water, either soaking without or with the addition of starter culture WGK4, increased. Decreases in soluble protein in the Komak beans without LAB addition could be due to the protein leaking from the beans to the soaking water. Addition of WGK4 lowered the soluble protein in soaking water and beans. During soaking, LAB used nutrients, including soluble proteins, for their growth and metabolic activity. These bacteria could produce proteolytic enzymes such as proteases and peptidases, which provided nitrogen sources for their growth and metabolic activity. Meng et al. [31] showed that soluble proteins in bean milk (soy, peanut and chickpea) decreased after fermentation with Lactobaci-llus fermentum GD01. The WGK4 grew well in black soymilk containing amino acids such as leucine, valine, glutamic acid, cysteine, arginine, methionine and histidine [20]. Raw Komak beans contain 18 various amino acids, including arginine, glutamic acid, leucine, valine and cysteine. These essential amino acids (EAAs) are needed by LAB, especially L. plantarum [32]. Soluble proteins in soaking water and Komak beans might contain these EAAs.

Minerals are micronutrient compounds detected in legumes. Komak beans are rich in potassium, magnesium, phosphorus, iron and calcium [2]. Raw beans contain 1686.95 mg of potassium, 150.26 mg of magnesium, 358.05 mg of phosphorus, 4.71 mg of iron and 123.07 mg of calcium per 100 g. After pressure-cooking, mineral content of the Komak beans decreased. Potassium, magnesium, phosphorus, iron and calcium concentrations in pressure-cooked Komak beans were nearly one-third to two-thirds lower than those in raw beans. The pressure-cooking process, which uses water as a medium, could cause minerals to leak into cooking water [33]. Mineral contents in Komak beans and soaking water after pressure-cooking soaked without and with WGK4 are shown in Table 4. The mineral mostly lost in the Komak beans was potassium. According to Damodaran et al. [34], potassium is present in foods as a free ion. Martinez-Pineda et al. [35] reported that pressure-cooking soaked chickpeas decreased potassium and phosphorus contents by 88.9 and 67.2% with final values of 95 and 104.6 mg per 100 g, respectively. Pressure-cooking was carried out at 118 °C for 40 min. The pressure-cooking process led to the loss of the mineral concentration of the beans. After pressure-cooking, Komak beans were soaked without and with addition of WGK4.

The current study reported that soaking Komak beans decreased the mineral content. Soaking with addition of WGK4 decreased the potassium content by more than 50%. Decreases in minerals of the Komak beans resulted in increases in minerals in the soaking water. The mineral loss during soaking might be due to the release of minerals into the soaking water [36]. They reported that soaking white faba beans for 24 h decreased iron and phosphorus by 28 and 16%, respectively. Iron content of the cowpeas decreased by 14% after soaking for 24 h [37]. However, concentration of the minerals in soaking water with the addition of WGK4 was much lower than that without the addition of WGK4 (Table 4). Increasing the soaking time with WGK4 significantly decreased minerals in Komak beans and soaking water. Technically, LAB need minerals in their growth media because they are unable to synthesize these essential nutrients. Therefore, media containing minerals must be provided. Soaking water provides minerals used by LAB for growth and metabolic activity. Examples of the minerals needed by LAB are Fe, Mg, Mn and Zn and their quantities vary depending on the microbial strain [38]. As reported by Leksono et al. [20], WGK4 LAB grew well in black soymilk containing minerals including iron, zinc, magnesium and manganese. Minerals were used to grow L. acidophilus KLDS 1.0738. During 14 h of fermentation, L. acidophilus KLDS 1.0738 utilized iron, magnesium and potassium at rates of 83.5, 27.2 and 9.6%, respectively [28]. This finding indicated that nutrients in the media could support growth of WGK4.

3.2.3. Anti-nutrient Factors of Komak Beans

Raw Komak beans contained 11.77 mg.g-1 ±0.97 phytic acid, 2.14 mg.g-1 ±0.02 trypsin inhibitor and 11.94 mg.g-1 ±0.23 tannin (Table 2). Pressure-cooking for 15 min decree-sed more than 50% of these anti-nutrient factors to 5.77 mg.g-1 ±0.34, 0.16 mg.g-1 ±0.03 and 4.56 mg.g-1 ±0.58 for phytic acid, trypsin inhibitor and tannin, respectively. Soaking the Komak beans without WGK4 addition did not significantly decrease contents of the anti-nutrient factors, except for tannin which decreased by more than 50% after 24 h of soaking (Table 5). Soaked Komak beans with the addition of WGK4 significantly decreased the anti-nutrient factors, compared to pressure-cooked beans. Decreases in phytic acid contents throughout fermentation might be associated to the phytase enzyme activity of beans and microbial fermentation [17]. Previous studies have shown that LAB fermentation can decrease the phytic acid contents of materials [17, 39]. For example, fermentation of kidney beans and faba bean flour for 24 h, using L. plantarum BFE5092 and L.plantarum E-78076, resulted in 28 (5.02 to 3.61 mg.g-1) and 14% (9.7 to 8.9 mg.g-1) decreases in phytic acid, respectively. Pressure-cooking followed by soaking with addition of WGK4 significantly eliminated phytic acid in the Komak beans. Although phytic acid is an anti-nutritional component, low levels of phytic acid are beneficial for health such as prevention of diabetes [40]. Consumption of phytic acid is safe and can be consumed up to 4500 mg per day [41].   

As shown in Table 5, trypsin inhibitor content was unaffected by addition of LAB to Komak beans. It showed relatively consistent values ranging 0.13-0.15 TIU.mg-1. Chandra-Hioe et al. [42] reported no significant differences in the content of trypsin inhibitor of chickpeas and faba bean flour fermented by LAB for 16 h. Addition of LAB significantly decreased tannin content of the Komak beans, with tannin content ranging 1.16-1.45 mg.g-1. Tannin content in soaked kidney beans fermented with L. plantarum BFE 5092 for 24 h decreased by 7% (3.07 to 2.83 mg.g-1) [17]. Decreases in tannin in Komak beans fermented with WGK4 could be linked to the ability of LAB to hydrolyze the tannin complex. Tannin content in Komak beans could be decreased by pressure-cooking followed by the addition of WGK4 during soaking. Tannin is safe to consume and consumption less than 1.5-2.5 g per day shows no side effects [43].

3.2.4. Volatile Compounds of Komak Beans

Volatile compounds in raw Komak beans were identified as aldehydes, alcohols, phenols, hydrocarbons, ketones, pyrazines, acids, esters, terpenes, furans and naphthalene (Table 6). After pressure-cooking for 15 min, concentrations of the volatile compounds, except aldehydes, mostly decreased. Further decreases in volatile compound concentrations were detected when Komak beans were soaked with or without addition of WGK4. Soaking Komak beans for 16 h with addition of WGK4 were selected since it achieved an appropriate pH value for mold fermentation. Similar to other legumes, Komak beans include a distinctive aroma that can affect consumer perception and hence limit their use. This distinct aroma is associated with an unpleasant odor, also called beany flavor. Volatile compounds contributing to the beany flavor have been described as beany, green and earthy [44, 45], derived from volatile aldehydes such as hexanal, nonanal and (E, E)-2, 4-nonadienal; alcohols such as 1-hexanol and 1-octen-3-ol; ketones such as 3-octen-2-one; and furan such as 2-pentyl furan [18, 44, 46]. In Komak beans, volatile compounds of the aldehyde group associated with beany flavor include nonanal and (E, E)-2, 4-nonadienal. Nonanal concentration of the beans soaked with addition of WGK4 was significantly lower than that of the pressure-cooking treatment. Nonanal and (E, E)-2, 4-nonadienal was detected at the beginning of soaking because of pressure-cooking. Increases in aldehyde compounds in yellow and grey peas (Pisum sativum) were reported due to enzymatic and non-enzymatic oxidation processes during heating [47]. Moreover, (E, E)-2, 4-nonadienal was undetected in Komak beans fermented with WGK4. According to Pei et al. [46], pea flour fermentation with L. rhamnosus L08 for 6 h decreased this compound to undetectable levels.

After soaking Komak beans with addition of WGK4 for 16 h, 1-octen-3-ol, an alcohol compound and 2-pentyl-furan, contributing to the beany flavor, were not detected. It might be linked to the enzymatic activity of these LAB. Significant decreases in 1-octen-3-ol were observed in L. plantarum X7021 soymilk fermentation. These decreases might be attributed to the strong oxidoreductase system of these LAB [48]. This result is similar to that of Saadoun et al. [49] in okara fermentation using L. acidophilus 8151, P. acidilactici 3992 and L. rhamnosus 1473. Furthermore, decreases in 2-pentyl furan by LAB fermentation were demonstrated by Saadoun et al. [49]. In addition to disappearance of volatile compounds contributing to the beany flavor, several pleasant odors were detected in Komak beans during 16-h soaking with addition of WGK4. These volatile compounds included 3-carene (citrus), D-limonene (citrus) and cis-β-farnesene (citrus green). This indicated that addition of WGK4 in the soaking step not only decreased pH of the Komak beans to desirable levels, but also decreased the beany flavor and tannin levels and produced volatile compounds responsible for the pleasant flavors.

3.3. Komak Tempe with Soaking in Lactiplanti-bacillus plantarum subsp. plantarum WGK4

Pressure-cooking followed by soaking Komak beans for 16 h with addition of WGK4 shortened the soaking time and decreased water requirements to one-sixth, compared to traditional Komak Tempe production. Tempe production needs a large quantity of water for soaking, water changes and boiling, which subsequently generates wastewater containing components that can pollute the environment. In the pre-mold fermentation process of jack bean Tempe production, beans with a hard texture were soaked for 24 h, boiled for 30 min and then soaked for 24 h. Then, beans were peeled and sliced into 4–6 pieces and soaked for 48 h. Soaking water was changed every 12 h. Sliced beans were boiled for 30 min. This process needed a large quantity of water and a soaking time of 96 h [4]. In this study, the soaking time was 16 h, which included a faster method. Studies by [5] on velvet beans revealed that the beans were soaked for 24 h, boiled for 30 min, peeled, sliced, soaked for 96 h with water changes every 12 h and boiled again for 30 min. This process needed eight times more water and included a longer time. Therefore, method used in this study was shorter and involved a fewer steps than that other processing methods did.

A 48-h fungal fermentation of the Komak beans formed compact mycelia, white cake-form products (data not shown), containing 6.23% ±0.55 soluble protein and anti-nutrient factors of 3.46 mg.g-1 ±0.21 phytic acid, 0.13 TIU.mg-1 ±0.03 trypsin inhibitor and 6.69 mg.g-1 ±0.26 tannin. Mold fermentation increased the soluble protein of the Komak Tempe by 59.8%. Raw Komak beans included a protein solubility value of 1.67%. Increases in soluble protein during Tempe fermentation were caused by the presence of protease enzymes produced by the molds throughout the fermentation [50]. Proteolytic enzyme activity is considered as the major factor in protein hydrolysis during Tempe fermentation, causing releases of peptides and free amino acids, thereby increasing dissolved nitrogen. Protein solubility in soybean, chickpea, pea and horse bean Tempe respectively increased by 66.4, 62.7, 62.3 and 60.7%, compared to raw beans [51]. Increases in soluble protein during Tempe fermentation could include positive effects on the nutritional quality of Tempe. As the protein in beans is broken down into simpler forms during ferment-ation, protein solubility increases, making it easier for the body to absorb the protein.

The anti-nutritional components of Komak Tempe resulting from the addition of WGK4 during soaking are present in Table 7. Phytic acid in Komak Tempe decreased from 4.96 to 3.46 mg.g-1 compared to beans prior to Tempe fermentation (beans soaked with WGK4) (Tables 5 and7). Fermentation of Rhizopus oligosporus generates phytase enzymes that hydrolyze phytic acid present in beans into organic phosphate and inositol [52]. Decreases in phytic acid were reported in soybean Tempe from 32.30 to 28.13 mg.g-1 and kidney bean Tempe from 3.90 to 3.53 mg.g-1, compared to cooked beans from dehulled soaked beans [53]. Phytic acid content observed in the Komak Tempe was lower than that in soybean and kidney bean Tempe.

 Trypsin inhibitor in the fermented Komak Tempe did not decrease. Trypsin inhibitor in the Komak Tempe was 0.13 TIU.mg-1. According to [6], thermal use (cooking and autoclaving) is more effective in eliminating trypsin inhibitors than the activity of microorganisms alone. For tannin contents, Tempe fermentation increased tannin contents of Komak Tempe, compared to the beans prior to Tempe fermentation (Tables 5 and 7). Tannin content of the Komak Tempe was 6.69 mg.g-1. This increase might be due to the enzymatic hydrolysis of condensed tannins [52]. Increases in tannin content of the velvet bean Tempe have been reported by Ezegbe et al. [54]. Tannin content of soybean Tempe was 7.6 mg.g-1 [52]. Although soybean Tempe contains anti-nutritional components such as phytic acid and tannin, it is widely consumed by Indonesian people, especially the Javanese. Therefore, Komak Tempe can safely be consumed as an alternative to soybean Tempe. Based on the findings of this study, addition of WGK4 during acid fermentation of softened Komak beans can be used for the Tempe production, resulting in Komak Tempes that are safe for consumption.

  1. Conclusion

Dehulled Komak beans pressure cooked for 15 min included a hardness value of 34.47 N. This value was close to the hardness value of boiled soybeans from traditional Tempe preparing. Pressure-cooking of Komak beans significantly decreased their anti-nutritional components, including phytic acid, trypsin inhibitor and tannin. Addition of L. plantarum subsp. plantarum WGK4 during the soaking step for 24 h decreased pH of the beans from 6.7 to 4.5.

These LAB use nutrients in the media such as soluble proteins and mineral elements for growth and metabolism. At the end of the soaking period, tannin level significantly decreased and the volatile compounds associated with the beany flavor were no longer available in the Komak beans. Therefore, L. plantarum subsp. plantarum WGK4 can potentially be used as a starter culture for acid fermentation in Tempe processing. Pressure-cooking and addition of these LAB significantly decreased the soaking time and water needed for Komak Tempe processing. These findings can highly help Tempe processing in resource-rich regions, as they shorten the processing time and save water. However, it is necessary to provide LAB culture starters in further applicable powdered forms.

  1. Acknowledgements

The authors thank the Ministry of Education and Culture of Indonesia for awarding Domestic Postgraduate Education Scholarships (no. B/67/D.D3/KD.02.00/2019). This study was carried out with independent funding.

  1. Conflict of Interest

The authors report no conflicts of interest.

  1. Authors Contributions

Conceptualization, T.U. and E.S.R.; methodology, W.W.; software, W.W.; validation, T.U., E.S.R. and W.S.; formal analysis, W.W.; investigation, W.W.; resources, T.U.; data curation, T.U., E.S.R. and W.S.; writing-original draft, W.W.; writing-review and editing, T.U., E.S.R. and W.S.; visualization, W.W.; supervision, T.U.; project administration, W.W.; funding acquisition, T.U.

References

  1. Listiana E, Sumarjan. Keragaan aksesi kacang komak (Lablab purpureus (L.) Sweet) Pulau Lombok. Crop Agro. 2008; 1(2): 97-103.
  2. Naeem M. Shabbir A, Ansari AA, Aftab T, Khan MMA, Uddin M. Hyacinth bean (Lablab purpureus)-An underutilised crop with future potential. Sci Hortic. 2020; 272.

https://doi.org/10.1016/j.scienta.2020.109551

  1. Kilonzi SM, Makokha AO, Kenji GM. Physical characteristics, proximate composition and anti-nutritional factors in grains of Lablab bean (Lablab purpureus) genotypes from Kenya. J Appl Biosci. 2017; 114: 11289-11298.

https://doi.org/10.4314/jab.v114i1.2

  1. Puspitojati E. Studi peptida bioaktif dari fermentasi tempe koro pedang putih (Canavalia ensiformis (L.) D.C.) sebagai inhibitor angiotensin i-converting enzyme (ACE). 2019. Doctoral dissertation. Universitas Gadjah Mada.

https://etd.repository.ugm.ac.id/penelitian/detail/182829

  1. Rahayu NA, Cahyanto MN, Indrati R. The pattern of changes in protein of velvet bean (Mucuna pruriens) during tempe fermentation using raprima inoculum. Agritech. 2019; 39(2): 128-135.

https://doi.org/10.22146/agritech.41736

  1. Starzyńska-Janiszewska A, Stodolak B, Mickowska B. Effect of controlled lactic acid fermentation on selected bioactive and nutritional parameters of tempeh obtained from unhulled common bean (Phaseolus vulgaris) seeds. J Sci Food Agric. 2014; 94: 359-366.

https://doi.org/10.1002/jsfa.6385

  1. Astawan M, Wresdiyati T, Widowati S, Bintari SH, Ichsani N. Phsyco-chemical characteristics and functional properties of tempe made from different soybeans varieties. J Pangan. 2013; 22(3): 241-252.
  2. Sridhar KR, Seena S. Nutritional and antinutritional significance of four unconventional legumes of the genus canavalia - A comparative Study. Food Chem. 2006; 99: 267-288.

https://doi.org/10.1016/j.foodchem.2005.07.049

  1. Ezeagu IE, Maziya-Dixon B, Tarawali G. Seed characteristics and nutrient and antinutrient composition of 12 mucuna accessions from Nigeria. Trop Subtrop Agroecosyst. 2003; 1: 129-139.
  2. Syanda JS. The effects of physical properties of common bean (Phaseolus vulgaris ) varieties on soaking and cooking time. 2019. Master of Science Thesis. South Eastern Kenya University.

https://repository.seku.ac.ke/handle/123456789/4462

  1. Siqueira BS, Vianello RP, Fernandes KF, Bassinello PZ. Hardness of carioca beans (Phaseolus vulgaris) as affected by cooking methods. LWT. Food Sci Technol. 2013; 54: 13-17.

https://doi.org/10.1016/j.lwt.2013.05.019

  1. Güzel D, Sayar S. Effect of cooking methods on selected physicochemical and nutritional properties of barlotto bean, chickpea, faba bean and white kidney bean. J Food Sci Technol. 2012; 49(1): 89-95.

https://doi.org/10.1007/s13197-011-0260-0

  1. Nurdini AL, Nuraida L, Suwanto A, Suliantari. Microbial growth dynamics during tempe fermentation in two different home industries. Int Food Res J. 2015; 22(4): 1668-1674.
  2. Pisol B, Abdullah N, Khalil KA, Nuraida L. Isolation and identification of lactic acid bacteria from different stages of traditional Malaysian tempeh production. Malays J Microbiol. 2015; 11(4): 358-364.

https://doi.org/10.1017/CBO9781107415324.004

  1. Yudianti NF, Yanti R, Cahyanto MN, Rahayu ES, Utami T. Isolation and characterization of lactic acid bacteria from legume soaking water of tempeh productions. 10th Asian Conferences of Lactic Acid Bacteria. Digital Press Life Sciences 2: 00003. 2020; 1-7.

https://doi.org/10.29037/digitalpress.22328

  1. Pisol B, Abdullah N, Khalil K, Nuraida L. Antimicrobial activity of lactic acid bacteria isolated from different stages of soybean tempe production. Aust J Basic Appl Sci. 2015; 9(28): 230-234.
  2. Kitum VC, Kinyanjui PK, Mathara JM, Sila DN. Effect of plantarum BFE 5092 fermentation on antinutrient and oligosaccharide composition of whole red haricot bean (Phaseolus vulgaris L). Int J Food Sci. 2020; 1-8.

https://doi.org/10.1155/2020/8876394

  1. Liang Z, Yi M, Sun J, Zhang T, Wen R, Li C, Reshetnik EI, Gribanova SL, Liu L, Zhang G. Physicochemical properties and volatile profile of mung bean flour fermented by Lacticaseibacillus casei and Lactococcus lactis. LWT - Food Sci. Technol. 2022; 163: 113565.

https://doi.org/10.1016/j.lwt.2022.113565

  1. Magdalena S, Hogaputri JE, Yulandi A, Yogiara Y. The addition of lactic acid bacteria in the soybean soaking process of tempeh. Food Res. 2022; 6 (3): 27-33.

https://doi.org/10.26656/fr.2017.6 (3).304

  1. Leksono BY, Cahyanto MN, Rahayu ES, Yanti R, Utami T. Enhancement of antioxidant activities in black soy milk through isoflavone aglycone production during indigenous lactic acid bacteria fermentation. Fermentation 2022; 8: 326.

https://doi.org/10.3390/fermentation8070326

  1. AOAC International. Official Methods of Analysis of AOAC International 21st ed. Maryland, USA. 2019.
  2. Hartree EF. Determination of protein: A modification of the lowry method that gives a linear photometric response. Anal Biochem. 1972; 48: 422-427.
  3. Fitriani A, Santoso U, Supriyadi S. Conventional processing affects nutritional and antinutritional components and in vitro protein digestibility in kabau (Archidendron bubalinum). Int J Food Sci. 2021.

https://doi.org/10.1155/2021/3057805

  1. Akkad R, Kharraz E, Han J, House JD, Curtis JM. Characterisation of the volatile flavour compounds in low and high tannin faba beans (Vicia faba Minor) grown in Alberta, Canada. Food Res Int. 2019; 120: 285-294.

https://doi.org/10.1016/j.foodres.2019.02.044

  1. Shimelis EA, Rakshit SK. Effect of processing on antinutrients and in vitro protein digestibility of kidney bean (Phaseolus vulgaris) varieties grown in East Africa. Food Chem. 2007; 103(1): 161-172.

https://doi.org/10.1016/j.foodchem.2006.08.005

  1. Batista KA, Pereira WJ, Moreira BR, Silva CN, Fernandes KF. Effect of autoclaving on the nutritional quality of hard-to-cook common beans (Phaseolus vulgaris). Int J Environ Agric Biotechnol. 2020; 5(1): 22-30.

https://doi.org/10.22161/ijeab.51.4

  1. Kalpanadevi V, Mohan VR. Effect of processing on antinutrients and in vitro protein digestibility of the underutilized legume, Vigna unguiculata (L.) Walp subsp. unguiculata. LWT - Food Sci. Technol. 2013; 51(2): 455-461.

https://doi.org/10.1016/j.lwt.2012.09.030

  1. Lv X, Liu G, Sun X, Chen H, Sun J, Feng Z. Nutrient consumption patterns of Lactobacillus acidophilus KLDS 1.0738 in controlled pH batch fermentations. J Dairy Sci. 2017; 100: 5188-5194.

https://doi.org/10.3168/jds.2017-12607

  1. Bhardwaj HL, Hamama AA. Fatty acids and sugars in lablab seed produced in Virginia (A non-traditional location). J Agric Sci. 2019; 11(17): 28-34.

https://doi.org/10.5539/jas.v11n17p28

  1. Singh BP, Vij S. α-Galactosidase activity and oligosaccharides reduction pattern of indigenous lactobacilli during fermentation of soy milk. Food Biosci. 2018; 22: 32-37.
  2. Meng J, Wang JL, Hao YP, Zhu MX, Wang J. Effects of Lactobacillus fermentum GD01 fermentation on the nutritional components and flavor substances of three kinds of bean milk. LWT. 2023; 184: 115006.

https://doi.org/10.1016/j.lwt.2023.115006

  1. Teusink B, Molenaar D. Systems biology of lactic acid: for food and thought. Current Opin Syst Biol. 2017; 6:7-13.

https://doi.org/10.1016/j.coisb.2017.07.005

  1. Raes K. Knockaert D, Struijs K. Van Camp J. Role of processing on bioaccessibility of minerals: influence of localization of minerals and anti-nutritional factors in the plant. Trends Food Sci Technol. 2014; 37(1): 32-41.

https://doi.org/10.1016/j.tifs.2014.02.002

  1. Damodaran S, Parkin K, Fennema OR. Fennema’s Food Chemistry. CRC press, Boca Raton, 2007: 524-560.
  2. Martínez-Pineda M, Yagüe-Ruiz C, Caverni-Muñoz A, Vercet-Tormo. A. Cooking legumes: a way for their inclusion in the renal patient diet. J Ren Nutr. 2019; 29: 118-125.

https://doi.org/10.1053/j.jrn.2018.08.001

  1. Luo Y, Xie W. Effect of soaking and sprouting on iron and zinc availability in green and white faba bean (Vicia faba ). J Food Sci Technol. 2014; 51: 3970-3976.

https://doi.org/10.1007/s13197-012-0921-7

  1. Lestienne I, Icard-Vernière C, Mouquet, Picq C, Trèche S. Effects of soaking whole cereal and legume seeds on iron, zinc and phytate contents. Food Chem. 2005; 89: 421-425.

https://doi.org/10.1016/j.foodchem.2004.03040

  1. Holzapfel WH, Wood BJB. Lactic acid bacteria: biodiversity and taxonomy. John Wiley & Sons, Chichester, 2014: 13-20.
  2. Rosa-Sibakov N, Re M, Karsma A, Laitila A, Nordlund E. Phytic acid reduction by bioprocessing as a tool to improve the in vitro digestibility of faba bean protein. J Agric Food Chem. 2018; 66: 10394-10399.

https://doi.org/10.1021/acs.jafc.8b02948

  1. Kumar A, Singh B, Raigond P, Sahu C, Mishra UN, Sharma S, Lal MMK. Phytic acid: blessing in disguise, a prime compound required for both plant and human nutrition. Food Res Int. 2021; 142: 110193.

https://doi.org/10.1016/jfoodres.2021.110193

  1. Reddy NR, Sathe SK. Food phytates. CRC Press, Boca Raton, 2001: 24-50.
  2. Chandra-Hioe MV, Wong CHM, Arcot J. The potential use of fermented chickpea and faba bean flour as food ingredients. Plant Foods Hum Nutr. 2016; 71: 90-95.

https://doi.org/10.1007/s11130-016-0532-y

  1. Sharma K, Kumar V, Kaur J, Tanwar B, Goyal A, Sharma R, Gat Y, Kumar A. Health effects, sources, utilization and safety of tannins: A critical review. Toxin Rev. 2019; 40: 432-444.

https://doi.org/10.1080/15569543.2019.1662813

  1. Roland WSU, Pouvreau L, Curran J, van de Velde F, de Kok PMT. Flavor aspects of pulse ingredients. Cereal Chem. 2017; 94: 58-65.

https://doi.org/10.1094/CCHEM-06-16-0161-FI

  1. Rajhi I, Baccouri B, Rajhi F, Hammami J, Souibgui M, Amri M, Mhadhbi H, Flamini G. Evaluation of germination effect on volatile compounds of different faba bean cultivars using HS-SPME/GC-MS. J Food Compos Anal. 2022; 112: 104692.

https://doi.org/10.1016/j.jfca.2022.104692

  1. Pei M, Zhao Z, Chen S, Reshetnik EI, Gribanova SL, Li C, Zhang G, Liu L, Zhao L. Physicochemical properties and volatile components of pea flour fermented by Lactobacillus rhamnosus Food Biosci. 2022; 46: 101590.

https://doi.org/10.1016/j.fbio.2022.101590. 

  1. Ferawati F, Witthöft C, Bergström M. Characterization of volatile compounds in Swedish yellow and gray peas: implications for new legume-based ingredients. Legum Sci. 2020; 2: e55.

https://doi.org/10.1002/leg3.55

  1. Du L, Ro KS, Zhang Y, Tang YJ, Li W, Xie J, Wei D. Effects of Lactiplantibacillus plantarum X7021 on physicochemical properties, purines, isoflavones and volatile compounds of fermented soymilk. Process Biochem. 2022; 113: 150-157.

https://doi.org/10.1016/j.procbio.2021.12.028

  1. Saadoun JH, Calani L, Cirlini M, Bernini V, Neviani E, Del Rio D, Galaverna G, Lazzi C. Effect of fermentation with single and co-culture of lactic acid bacteria on okara: Evaluation of bioactive compounds and volatile profiles. Food Funct. 2021; 12: 3033-3043.

https://doi.org/10.1039/D0FO02916E

  1. Astuti M, Meliala A, Dalais FS, Wahlqvist ML. Tempe, a nutritious and healthy food from Indonesia. Asia Pac J Clin Nutr. 2000; 9(4): 322-325.

https://doi.org/10.1046/j.1440-6047.2000.00176.x

  1. Ashenafi M, Busse M. Production of tempeh from various indigenous Ethiopian beans. World J Microbiol Biotechnol. 1991; 7: 72-79.
  2. Toor BS, Kaur A, Sahota PP, Kaur J. Antioxidant potential, antinutrients, mineral composition and FTIR spectra of legumes fermented with Rhizopus oligosporus. Food Technol Biotech. 2021; 59(4): 530-542.

https://doi.org/10.17113/ftb.59.04.21.7319

  1. Abu-Salem FM, Mohamed RK, Gibriel AY, Rasmy NM. Level of some antinutritional factors in tempeh produced from some legumes and jojoba seeds. Int Sch Sci Res Innov. 2014; 8: 296-301.
  2. Ezegbe CC, Nwosu JN, Owuamanam CI, Victor-Aduloju TA, Nkhata SG. Proximate composition and anti-nutritional factors in Mucuna pruriens (velvet bean) seed flour as affected by several processing methods. Heliyon. 2023; 9(6): e18728.

https://doi.org/10.1016/j.heliyon.2023.e18728

 

 

 

 

Bioactivity Assay of Microalgae: Antioxidant and Antidiabetic Potentials in a Transgenic Zebrafish Model

Tayebeh Hadi Toranposhti, Fakhri Sadat Hosseini, Mohammad Rezaei, Yaser Tahamtani

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e25
https://doi.org/10.22037/afb.v11i1.45488

Background and Objective: Microalgae with antioxidant, alpha-amylase and alpha-glucosidase inhibition and NF-κB activation abilities have shown promising anti-diabetic characteristics. The present study aimed to assess effects of microalgae extracts of Arthrospira platensis and Chlorella vulgaris on β-cell regeneration using Tg (ins: CFP-NTR) in a transgenic zebrafish type-1 diabetic model.

Material and Methods: After 15 d of cultivation of microalgae, cells were extracted from the biomass. Biochemical assays such as assessments of carbohydrates, proteins, lipids, phenolic compounds and photosynthetic pigments were carried out. Transgenic zebrafish larvae were treated in vivo, with five various concentrations of the extract (500, 125 31.25, 7.81 and 1.95 µg.ml-1).

Results and Conclusion: Results showed that aqueous extracts of Arthrospira platensis and Chlorella vulgaris included significant effects on β-cell regeneration in concentrations of 31.25, 7.81 and 1.95 µg.ml-1 and 125, 31.25, 7.81 and 1.95 µg.ml-1, respectively. The highest regeneration rates for Chlorella vulgaris and Arthrospira platensis extracts were observed at 125 and 31.25 µg.ml-1, respectively (60 against 92%) (P < 0.05). Additionally, aqueous extracts of Chlorella vulgaris showed the highest antioxidant activity (93.77 ±2.39) at 2500 µg.ml-1. Regarding significant inhibitory and antioxidant effects of these microalgae, promising use of their extracts can be suggested. Therefore, optimizing natural extracts and carrying out further studies are necessary to verify the current results.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Microalgae are rich sources of vitamins and minerals, including vitamins A, B1, B2, B3, B5, B7, C and E, nicotine, folic acid, iodine, potassium, iron, magnesium and calcium [1]. In recent decades, microalgae biomass and their extracts have been used to enrich drinks (e.g. fruit juices and milks) and foods [2] (e.g. breads, confectionaries and yogurts) [3,4]. Interestingly, a significant advantage of cyanobacteria is the absence of polysaccharides in their cell walls, which not only enhances their biocompatibility but also facilitates their easier digestion for humans [1]. The species of Arthrospira (A.) platensis of the Oscillatoriaceae family includes a group of filamentous cyanobacteria characterized by cell chains (trichomes) enclosed in a thin sheath [5]. The A. platensis contains large quantities of proteins, all essential amino acids, essential fatty acids, minerals, vitamins and photosynthetic pigments [6]. Moreover, A. platensis, due to its high protein and nutritional value, and Chlorella (C.) vulgaris, due to its β-1,3-glucan which is an active immune stimulator that can eliminate free radicals and decrease blood lipids, have nutritional uses for humans, used as food supplements [7]. The C. vulgaris microalgae are unicellular and grow in freshwater, which contain proteins, polysaccharides, lipids, unsaturated fatty acids and carotenoids (mainly lutein) as well as immune stimulants, vitamins and minerals [8,9]. Moreover, phycocyanin is a phycobiliprotein in cyanobacteria and algae such as A. platensis and is a pigment-protein complex in the phycobiliprotein family of light-absorbing proteins that exist with allophycocyanin and phycoerythrin. It is a light blue pigment that absorbs orange and red lights at 620 nm and emits fluorescence at nearly 650 nm. Absorbance at 620 nm indicates the maximum absorption of phycocyanin [10].

Type 1 or insulin-dependent diabetes is caused by autoimmune destruction of pancreatic β-cells and accounts for nearly 5–10% of all diabetic patients. Chronic diabetes can damage multiple organs and lead to their dysfunctions and hence high mortalities [11]. Islet transplantation as a promising treatment option includes limitations due to the lack of available donors [12]. For the first time, formation of new islets through budding of pancreatic ductal cells was demonstrated [13]. Furthermore, assessment of β-cell ablation by chemical treatments in rodents showed a significant improvement in β-cell mass, suggesting that the mature pancreas can partially be regenerated [14]. Pancreatic β-cells include a weaker antioxidant defense system (enzyme catalase, superoxide dismutase and glutathione peroxidase), compared to other tissues and organs, which makes these cells further sensitive to oxidative stresses [15]. Because of chronic hyperglycemia, oxidative stress can trigger various signaling pathways and thus worsen β-cell dysfunction. Furthermore, oxidative stress can cause death of β-cells due to an abnormal increase in the level of free radicals [16]. The antioxidant effect of algae can prevent destruction of β-cells and prevent type 1 diabetes. Several studies have reported that antioxidant characteristics of microalgal carotenoids [17], phycocyanins [18] and polysaccharides [19].

To assess effects of microalgae on diabetes, various animal models such as mice, rats and zebrafish have been used in previous studies. Zebrafish is an excellent model for in vivo designed studies; small size, transparency of larvae, ease of collecting large numbers of embryos, possibility of in vivo assessed candidate molecules and/or rapid screening, as well as possibility of live imaging at the level of organisms are advantages of this model [20]. While zebrafish can regenerate their pancreatic β-cells during their life, regenerative ability of the adult mammalian β-cells is limited [21]. In Tg(ins:CFP-NTR) transgenic zebrafish model, nitroreductase gene of Escherichia coli is expressed under the control of insulin promoter, which is harmless to the organism under normal physiological conditions. However, NTR converts metronidazole (MTZ) into a toxic product; hence, treatment of this transgenic model with MTZ leads to β-cell apoptosis. In Tg(ins: CFP-NTR) zebrafish larvae, destruction of β-cells occurs within 24 h. Importantly, β-cell mass and function are restored within a few days after MTZ washout. In adult fish, high blood sugar and absence of β-cells are observed 3 d after MTZ treatment and recover by 2 w. The β-cells of transgenic larvae express a cyan fluorescent protein (CFP) and therefore tracking of these cells can be carried out easily using fluorescent microscope [22]. Due to the increase in the incidence of diabetes worldwide, various studies in the field of prevention and treatment of diabetes have been carried out. It is important to use responsive models such as transgenic zebrafish to investigate food and drug sources. This study aimed to investigate potentials of A. platensis and C. vulgaris extracts in the regeneration of pancreatic β-cells using Tg(ins: CFP-NTR) transgenic zebrafish model. This is a novel model for studying type 1 diabetes used in various medicinal formulations.

  1. Materials and Methods

2.1. Cultivation and assessment of the growth rate of microalgae

A cell suspension of A. platensis was cultivated in Zarrouk´s media (24 × 104 cell.ml-1) at 28 °C and pH 9 ±1, as well as 24 h exposure to light [23]. Sorokin and Krauss culture medium [24] was used for the cultivation of C. vulgaris and the culture conditions included 24-h exposure, 20 °C and pH 6 ±1. To assess growth of the cells, cell counting and absorbance reading of the cultures were carried out. Absorbance readings for C. vulgaris and A. platensis cultures were carried out at 750 and 680 nm, respectively. Furthermore, samples were collected from the cultures every 3 d and growth rate and number of cells per milliliter were calculated using hemocytometer slide and Eqs. 1 and 2 for A. platensis [25] and C. vulgaris, respectively.

 

                                                    Eq. 1

 

Where, K was number of the cells per milliliter, N1 was number of the cells at time t, N0 was number of the cells at 0 time and t was the time (d).

 

Cell count per milliliter = total number of counted cells / number of counted blocks                                         Eq. 2

 

Suspension of A. platensis was harvested after 15 d of culture and separated using Nylon membranes with 25-µm pore sizes and suspension of C. vulgaris was centrifuged at 3773 g for 15 min to collect the biomass [9]. Biomasses were dried under biosafety hood at laboratory temperature for a w and stored at 4 °C until use.

2.2. Extraction of microalgae

2.2.1. Extraction with water as solvent without pretreatment using ultrasonic device (US)

A mixture of 5 g of A. platensis and 5 g of C. vulgaris powder were dissolved in 50 ml of distilled water (DW), transferred to a glass container with a lid and then incubated at 70 °C for 24 h using water bath. They were filtered through filter papers and lyophilized at -55 °C for 24 h with a pressure of 0.6 mbar for long-term storage, using Christ Alpha 1-4 device [26].

2.2.2. Extraction with water solvent and treatment using ultrasonic device (US+)

First, 2 g of A. platensis dry powder and 2 g of C. vulgaris powder were added to 200 ml of DW with pH 6 and treated for 15 min at 4 °C using ultrasonic device with an intensity of 50 MHz. This product was centrifuged at 966 g for 15 min at 4 °C. Then, supernatant was collected and lyophilized for long-term storage [10].

2.2.3. Extraction with methanol as solvent

For preparing methanolic extract of A. platensis and C. vulgaris biomasses, 1 g of dry powder of each species was dissolved in 100 ml of 80% (v/v) methanol and agitated for 24 h at 20 °C. Then, samples were filtered using filter papers and supernatant was lyophilized for long-term storage [27].

2.3. Quantitative phytochemical analysis

2.3.1. Assessment of carbohydrates

Phenol-sulfuric acid method was used for total carbohydrate assessment. Briefly, 0.001 g of A. platensis and C. vulgaris dry powders was added to 1 ml of DW, then 1 ml of 5% (w/v) aqueous phenol and 5 ml of 96% sulfuric acid were added to this solution. Samples were set at room temperature (RT) for 25 min. Using Unico 2100 UV-VIS spectrophotometer, total reducing sugars were estimated at 490 nm. Glucose in the range of 0–100 µg.ml-1 was used to draw the standard curve [28].

2.3.2. Photosynthetic pigments estimation

In general, 1 g of dry A. platensis and C. vulgaris powder was added to 50 ml of 100% acetone and samples were homogenized for 1 min at 15 g using Wise HG-15D cube homogenizer device. Then, samples were filtered using cotton and centrifuged at 94 g for 10 min at 4 °C and then supernatant was collected. To measure the chlorophyll content, absorbance of the samples was measured using microplate reader at 662, 645 and 470 nm, which were the maximum absorbance for chlorophyll a, chlorophyll b and total chlorophyll, respectively. In this study, Eqs. 3, 4 and 5 were used to calculate these chlorophyll values. Acetone 100% was used as blank in this experiment [29].

 

Ca = 11.75 A662 - 2.350 A645                                                                   Eq. 3

 

Where, Ca was the quantity of chlorophyll a, A662 was the absorbance at 662 nm and A654 was the absorbance at 654 nm.         

 

Cb = 18.61 A645 - 3.960 A662                                                                    Eq. 4

 

Where, Cb was the quantity of chlorophyll b, A654 was the absorbance at 654 nm and A662 was the absorbance at 662 nm.

 

Cx+c = 1000 A470 - 2.270 Ca - 81.4 Cb / 227                     Eq. 5

Where, Cx+C was the quantity of total chlorophyll, A470 was the absorbance at 470 nm and Ca was the quantity of chlorophyll a and Cb was the quantity of chlorophyll b.

2.3.3. Assessment of phenolic compounds

Total soluble phenolic content of the algae extracts was assessed using a method by Yucetepe et al. [30]. Content of the phenolic compounds in the extracts was assessed using Folin-Ciocalteu reagent. Thus, 0.2 ml of the extract and 0.2 ml of diluted Folin-Ciocalteu reagent (1:15) were mixed and after 5 min, 2.5 ml of 7% calcium carbonate solution were added to the mixture. Using DW, volume of the samples was adapted to 5 ml and after 90 min, absorbance of the samples was read at 750 nm. Total phenols were expressed as Gallic acid equivalents per gram dry weight of the sample.

2.3.4. Assessment of proteins

To measure the protein content, proteins must be extracted from the cells. Therefore, 15 ml of DW were added to 1 g of dry C. vulgaris and A. platensis powder and transferred onto a magnetic stirrer for 60 min at RT. These samples were transferred to an ultrasonic machine for 30 min at 4 °C with an intensity of 70 Hz. These were centrifuged at 4000 g for 30 min at 4 °C. The supernatant was collected and pH was adjusted to 3 using 0.1 M hydrochloric acid and 0.1 M sodium hydroxide. To collect sediments, samples were centrifuged at 4000 g for 30 min at 4 °C. Then, 2.5 ml of Bradford reagent were added to 250 µl of protein and the absorbance was read at 595 nm using spectrophotometer [31]. Using bovine serum albumin as the standard curve, protein concentration was assessed.

2.3.5. Assessment of lipids

For lipid assessment, 0.5 g of dry powder of A. platensis and C. vulgaris was transferred into a Soxhlet machine with 150 ml of n-hexane and incubated at 145 °C for 3 h [32]. Then, GC Agilent-6820 gas chromatography machine with column specifications of 30 m × 0.25 mm × 0.25 µm and nitrogen carrier gas was used to characterize fatty acids of the samples. The injection volume was 1 µl, the injection mode was split and the temperature started from 100 °C. After 2 min, temperature increased to 240 °C using Rate 3 and to 280 °C using Rate 10.

2.3.6. Assessment of phycocyanin content in aqueous extracts of A. platensis

The evaluation of the amount of phycocyanin and antioxidant tests after the treatment of zebrafish larvae with different concentrations of extracts and the evaluation of their effectiveness has been done. The quantity of phyc-ocyanin in aqueous extracts of A. platensis was assessed by reading absorbance of the samples at 620 and 652 nm using spectrophotometer and Eq. 6 [10]:

 

Phycocyanin (mg.l-1) = (Abs620 - 0.474 × Abs652) / 5.34                                                                            Eq. 6

Where, A620 was the absorbance at 620 nm and A652 was the absorbance at 652 nm.

2.3.7. Assessment of antioxidants

Further analyses of the aqueous extracts and their antioxidant characteristics and phycocyanin contents were carried out using two methods of DPPH and iron chelation.

2.3.7.1. Antioxidant assessment of DPPH method

Briefly, 100 µl of 0.5 M DPPH were added to 100 µl of the sample by various concentrations, including 0.5, 1, 1.5, 2 and 2.5 mg.l-1 methanol. After complete pipetting, samples were set for 60 min at RT in dark. Then, absorbance of the samples was read at 517 nm. Methanol was used as the control and ascorbic acid as the positive control. Equation 7 was used to calculate the quantity of free radical inhibition as follows [33]:

 

Inhibition (%) = [(Abscontrol - Abssample) /Abscontrol)] × 100                                                                               Eq. 7

Where, Abscontrol was absorption rate of the DPPH solution and methanol and Abssample was absorption rate of the assessed sample.

Technically, IC50 is a number indicating the extract concentration, which can inhibit the oxidation process by 50%. The smaller the IC50 value, the higher the antioxidant activity [34].

2.3.7.2. Assessment of iron ion chelating activity

To carry out this assay, 50 µl of the samples were mixed in various concentrations (0.5,1,1.5,2 and 2.5 mg.l-1 DW) with 25 µl of 2 mM FeSO4 solution and then 50 µl of 5 mM ferrozine solution were added to the mixture. Mixture was agitated well and absorbance was read at 562 nm after 10 min. Moreover, DW was used as negative control and EDTA was used as positive control. Equation 8 was used to calculate the quantity of iron ion chelation [35]:

 

Chelating activity (%) = [(Abscontrol - Abssample) / Abscontrol] × 100                                                                       Eq. 8

 

Abscontrol was the absorbance rate of DW and ferrozine solution and FeSO4 and Abssample was the absorbance rate of the assessed sample.

2.4. Fish care and breeding

Adult zebrafish were grown using Tecniplast recircul-ating system with 14/10 of light/dark photoperiods and water temperatures of 28 °C, Royan Zebrafish Core Facility, Tehran, Iran. The Tg (ins: CFP-NTR) transgenic line and TU wild-type strain were used in all experiments, carried out using protocols approved by the Ethical Committee of Royan Institute, Tehran, Iran. The hemizygous Tg (ins: CFP-NTR) embryos (to avoid the variability of fluorescent intensity between hemizygous and homozygous larvae) were prepared by outcrossing of the transgenic Tg (ins: CFP-NTR) line with TU wild-type strain. Zebrafish embryos were cultured in E3 media and treated with 0.003% 1-phenyl-2-thiourea at 24 h post fertilization (hpf) till the end of the experiment. The 1-phenyl-2-thiourea completely suppressed pigmentation and enhanced trans-parency of the larvae, which was necessary for live imaging and quantification of a cyan fluorescent reporter.

2.4.1 Chemogenetic ablation

Zebrafish larvae at 72 hpf were exposed to a 10-mM solution of metronidazole (MTZ) for 24 h and then larvae were washed three times with E3 media. The MTZ treatment was adapted from the previously established protocol for near-full ablation of the β-cells in the pancreas of zebrafish larvae.

2.4.2. Treatment of larvae with the extracts

Treatment of larvae was carried out with five concen-trations of each compound (500, 125, 31.25, 7.81 and 1.95 µg.ml-1) from 4–6 d post fertilization (dpf). Thus, 15 β-cell ablated larvae were used for each concentration, including five larvae in 1.5 ml of E3 media in each well of 24-well plates. Three control groups were assessed, including none-treated control compromise larvae cultured in E3 media only, negative control consisted of larvae treated with MTZ for β-cell ablation without compound treatment in follow and positive control with larvae, which treated with NECA as a small molecule that increased β-cell regeneration after exposure to MTZ. At 6 dpf, live larvae were anesthetized with tricaine for imaging and images were captured using Olympus SZX16 fluorescence stereomicroscope equipped with a Canon digital camera. The effect of compounds on β-cell regeneration was assessed by measuring β-cell area (AU) in each larva using ImageJ software (NIH).

2.5. Statistical analysis

All experiments of this study were carried out three times and data were present as mean ±SD (standard deviation). One-way ANOVA was used to analyze statistical significances of data using GraphPad Prism 6 software. In general, p values less than 0.05 were recorded as significant.

  1. Results and Discussion

3.1. Characteristics of A. platensis and C. vulgaris extracts

Algal growth and biomass productivity were assessed using cell counting and absorbance reading. Growth of A. platensis and C. vulgaris was assessed for 15 d under certain conditions and the highest cell growth was achieved on Day 10 for A. platensis and on Day 9 for C. vulgaris (Figure 1).

In the present study, it was detected that A. platensis and C. vulgaris included antioxidant characteristics and caused regeneration of pancreatic β-cells in Tg(ins: CFP-NTR) transgenic zebrafish. Zarrouk’s medium was used for A. platensis cultivation and during the growth, temperature was set to a constant value of 28 °C, which resulted in the production of the highest biomass rate (3.27 g.l-1). Effects of temperature on growth rate and active mass of A. platensis in Zarrouk’s media under laboratory conditions were assessed in a study and it was reported that the highest quantity of microalgae active mass (2.74 g.l-1) was produced at 24 °C in Zarrouk´s media [36]. These results were similar to the present results. The pH value of the culture media was 8 on the initial days of A. platensis cultivation, which reached to 10 as cultivation time increased and at the beginning of the ascent stage. Alkaline pH (9 and 10) alone favored normal cell metabolism and the membrane function was not affected by the growth and chlorophyll content [37]. Additionally, it was reported that the maximum dry weight of the algal mass and contents of chlorophyll a and protein were produced at pH 10–9, [38]. Furthermore, it was demonstrated that the algae grown at pH 9 were able to decrease time of the lag phase, including the highest specific growth rate [39]. In this study, time of light exposure was set at 24 h without darkness. Tayebati et al. reported that the maximum growth of A. platensis was under red light and 24-h light cycle without darkness [40]. During the growth of C. vulgaris, temperature was set to a constant value of 20 °C and pH was set in the range of 6 ±2. In a study that investigated effects of various temperatures on the growth of C. vulgaris, it was shown that the maximum growth rate occurred at 25 °C [41]. Moreover, a study that investigated effects of pH (2, 5, 7, 9 and 11) and temperature (10, 20, 30 and 40 °C) on the growth and chemical composition of C. biomass reported that the optimal range of environmental conditions for the cultivation of microalgae included pH 7–9 and temperature of 20–30 °C [42].

3.2. Compounds of A. platensis and C. vulgaris

Quantity of carbohydrates in A. platensis was 61.76 ±2.44 μg.ml-1, which was almost 1.5 times higher than that in C. vulgaris. Quantity of total protein in A. platensis was approximately 1.5 times higher than that in C. vulgaris and quantity of phenolic compounds in A. platensis was higher than that in C. vulgaris with approximately 2.5 times. Quantities of carbohydrates, proteins and phenolic compounds are present in Table 1.

In the present study, quantity of total carbohydrates in A. platensis was 6.17%. Similarly, another study indicated that the quantity of total carbohydrate in this microalga was 6.46% ±0.32 [42]. In this study, quantity of total lipid was 3% for A. platensis. In another study, quantity of total lipid in A. platensis was 2.45±0.82 and 0.1% ±0.01, respectively [43]. Differences in the total lipid contents of the studies could be due to the differences in the types of solvent, time and temperature of the Soxhlet device. Quantity of total protein was 65.40% for A. platensis. In a previous study, it has been shown that quantity of A. platensis protein was 53.12% [44] possibly due to the various culture conditions and protein extraction methods. Quantity of photosynthetic pigments in micrograms per milliliter of solution volume is shown in Table 2. Quantity of total carotenoids in C. vulgaris was 0.912 ±0.15 µg.ml-1, which was higher than that in A. platensis. Moreover, quantities of chlorophyll a and b in C. vulgaris were approximately 2.5 and 10 times more than that in A. platensis, respectively.

Oleic acid and linoleic acid (ω6) were the major fatty acids in A. platensis and C. vulgaris, respectively. Results of the fatty acid profiling are shown in Tables 3.

Based on the profiling results of A. platensis fatty acids, the predominant fatty acids included oleic acid (53.3%), palmitic acid (22.8%), linoleic acid (14.1%) and stearic acid (9.6%). In a previous study, palmitic, γ-linolenic and linoleic acids were dominant fatty acids [41]. In a report, palmitic acid was the most dominant fatty acid in A. platensis [45]. In another study, it was shown that palmitic acid with 30.1% of the total fatty acids was dominant within saturated fatty acids (SFAs), and oleic acid with 34% was dominant within unsaturated fatty acids [46]. Additionally, profile of C. vulgaris fatty acids included linoleic acid (30.1%), oleic acid (24.8%), palmitic acid (22.6%), stearic acid (16.7%) and linolenic acid (5.68%). In a previous study, it was shown that palmitic acid and linolenic acid accounted for 25.17 and 9.66% of the total fatty acids, respectively, in C. vulgaris. In addition, it was shown that palmitic acid, stearic acid, oleic acid and linolenic acid were dominant fatty acids [46].

3.3. Quantity of phycocyanin in aqueous extracts of A. platensis

Based on Figure 2, no significant differences were seen in the quantity of phycocyanin in A. platensis aqueous extracts.

3.4. Pancreatic β-cell regenerative capacity of microalgal aqueous extracts

The average values of β-cell mass in Tg(ins: CFP-NTR) transgenic zebrafish larvae for all treated and control groups are illustrated in Figure 3A. Results showed that aqueous extracts without ultrasonication of A. platensis and C. vulgaris significantly increased β-cell area (AIU), compared to negative controls. For C. vulgaris, effects on β-cell regeneration increased with concentration (Figure 3B).

In a study, alloxan-induced diabetic rats were treated with A. platensis supplementation and results showed that A. platensis treatment led to significant decreases in fasting blood glucose and increases in glycogen levels. The A. platensis supplementation prevented body weight loss and improved hepatotoxicity indices such as alkaline phosphatase and transaminase activities, bilirubin level and lipid peroxidation. Overall, this study showed that A. platensis treatment decreased hyperglycemia and oxidative stress in diabetic rats [47]. Additionally, histopathological studies of the pancreas in a study showed that A. platensis included antidiabetic effects by increasing secretion of insulin from β-cells of the pancreatic islets. Moreover, effects of A. platensis on regeneration of the pancreatic islets were observed with regeneration of the islet cells [48].

The hypoglycemic effect of A. platensis was assessed in diabetic male albino rats as a mammalian model treated with streptozotocin and it was reported that A. platensis included antioxidant and antidiabetic effects in streptozotocin-induced diabetic rats [49]. In the present study, A. platensis extract included antioxidant characteristics and regenerated pancreatic β-cells.

Lee et al. investigated the protective effects of Spirulina maxima extracts in a cytokine-mediated type-1 diabetes model in vitro and in streptozotocin-induced diabetic Wistar rats in vivo. Interleukin-1 beta (IL-1β) and Interferon gamma (IFN-γ) caused significant cytotoxicity in mouse cells, increasing nitric oxide (NO), nuclear factor κB (NF-κB) and apoptosis associated with key genes. However, cytotoxicity of the cytokines significantly decreased using Spirulina extract, which effectively inhibited NO production and suppressed apoptosis. These results showed that Spirulina extract might be effective for preserving viability and function of pancreatic β-cells against cytotoxic condit-ions. In addition, diabetic rats that consumed Spirulina extract orally showed decreases in glucose levels, increases in insulin and improvements in liver enzyme markers. Anti-oxidant effects of Spirulina extract may be beneficial in type-1 diabetes treatment by increasing survival and decreasing or delaying cytokine-mediated destruction of β-cells [50]. In a study by Kulkarni et al. on Tg(ins: Flag-NTR)s950 zebrafish models, the researchers detected that MTZ induced reactive oxygen species (ROS) production in presence of NTR. Furthermore, they reported that the level of produced ROS was proportional to the dose of prodrug added to the system. At high doses of MTZ, caspase 3 was rapidly cleaved and β-cells shifted to regulated cell death [51]. Based on the results, it can be concluded that the extracts of A. platensis and C. vulgaris include antioxidant characteristics and thus prevent death of pancreatic β-cells.

Cytokines alter and regulate the expression level of several genes via transcription factors (e.g. NF-κB, STAT-1 and IRF-3) in β-cells [52]. The NF-κB signaling pathway is an important pathway in the regulation of inflammation [53]. The NF-κB is a significant transcriptional regulator in cells and normally binds to its inhibitor kappa B (IκB) of the cytoplasm in the inactive form of p50-p65 heterodimer [54]. In β-cells, IL-1β alone or in association with IFN-γ induces proteolysis of IκBα and increases translocation of NF-κB into the nucleus, where it can bind to specific κB sites on DNA to regulate transcription of target genes [55]. The NF-κB activation increases expression of downstream inflammatory mediators, including proinflammatory cyto-kines such as IL-1β, interleukin-6 (IL-6) and TNF-α [56]. Cytokine-induced NF-κB activation changes the gene expression profile of β-cells by affecting several genes involved in β-cell differentiation, recruitment and activation of immune cells and β-cell apoptosis. Inhibition of NF-κB activation or translocation leads to β-cell proliferation by suppressing β-cell damage or death induced by IL-1β and IFN-γ; therefore, NF-κB is an important transcription factor in pancreatic β-cells [57]. Studies have shown that species of A. platensis inhibit cytokine-mediated cell apoptosis in pancreatic β-cells. Moreover, A. platensis extract effectively destroys cytokine-induced IκBα to prevent the nuclear translocation of NF-κB p65 subunits and downregulates downstream genes associated with β-cell apoptosis to protect cells against NF-kB cytotoxicity [50].

3.5. Antioxidant activity of aqueous extracts and phycocyanin

Based on the DPPH assay, antioxidant activity of phycocyanin and water extracts of A. platensis and C. vulgaris showed that with increasing concentrations, the antioxidant activity increased and all extracts at concentration of 2.5 mg.l-1 included the highest activity (Figure 4). Moreover, the highest activity belonged to aqueous extract treated with ultrasonic microalgae of A. platensis at the concentrations of 2 and 2.5 mg.l-1. The IC50 values ​​ for A. platensis (US-), A. platensis (US+), C. vulgaris (US-), C. vulgaris (US+) and phycocyanin extracts were 1.25, 1.53, 1.14, 0.95 and 0.90 mg.l-1, respectively.

Antioxidant activities of phycocyanin and water extracts of A. platensis and C. vulgaris based on the iron chelation assay are shown in Figure 5. Results were similar to those of DPPH assay, 2.5 mg.l-1 in each extract included the highest antioxidant activity and the highest activity was linked to the aqueous extract treated with ultrasonic C. vulgaris at 2.5 mg.l-1. Results from the antioxidant assays showed that antioxidant activity increased with increases in the concentrations of phycocyanin and aqueous extracts of the microalgae. A study investigated antioxidant character-istics of alcoholic extracts of A. platensis and C. [58] and reported similar results. At concentration of 2.5 mg.l-1, the highest level of antioxidant activity with DPPH assay inhibition belonged to the aqueous extract of A. platensis (US+). This was significantly different from other extracts with similar concentrations. At high concentrations, the level of DPPH inhibitory activity in A. platensis was higher than that of C. vulgaris. The major active component of A. platensis is the phycocyanin pigment, which scavenges free radicals and includes high antioxidant activities [58,59], showing that the antioxidant capacity of phycocyanin and its bioactive components (phycocyanopeptide and phyco-cyanobilin) is as follows: phycocyanin > phycocyanobilin > phycocyanopeptide. As concentrations of these component increase, their antioxidant activities increase [59]. Phyco-cyanins as antioxidants (soluble in water) can prevent ROS production or their destruction in producing cells (cyano-bacteria) and in cells that consume these biochemical or are treated with them (animal cells). Researchers have shown that phycocyanins can remove hydroxyl radicals, alkoxyl radicals and superoxide anions. Furthermore, phycocyanins inhibit lipid peroxidation reactions and regenerate singlet oxygen, hypochlorous acid, peroxyl radical, peroxynitrite, NO and hydrogen peroxide [60].

In the present study, antioxidant activity increased with increases in the concentration of phycocyanins. This increase was not higher than that of other extracts with no significant differences. Antioxidant activity of the phenolic compounds is majorly due to their oxidation characteristics, reducing power and chemical structure, which can play important roles in neutralizing free radicals, forming complexes with metal ions and quenching single and triple oxygen molecules [61]. A study was designed to investigate aqueous, ethanol and acetone extracts of several algae (Spirogyra sp., Spirulina sp., Chlorella sp. and Chara sp.) to assess antioxidant capacities of the extracts as well as their DPPH radical scavenging activities. It was concluded that Spirulina sp. included significant total phenolic composition and antioxidant activity, compared to other species. Results of the phenolic compounds in this study showed that A. platensis microalgae included higher phenolic compounds than that C. vulgaris did. Due to the lack of significant antioxidant activity of phycocyanins and presence of vitamins such as vitamins K and E and amino acids in A. platensis, its high antioxidant activity at high concentrations could be attributed to compounds other than phycocyanins. Presence of other bioactive factors such as vitamin C and proteins that are soluble in water increases antioxidant activity because comparison of various quant-ities of phycocyanins have shown that antioxidant activity is more significant in algal extracts at similar concentrations of phycocyanins. This could be linked to antioxidant activity of other factors in the aqueous extract of algae [62].

Based on the findings, increases in the concentration of aqueous extracts of microalgae could result in increases in metal chelation activity; thus, concentration of 2.5 mg.l-1 included the highest antioxidant activity. A significant difference was detected in the concentration of 2.5 mg.l-1 aqueous extract (US+) of C. vulgaris with other extracts. These results showed that use of ultrasonic devices could increase the chelating activity of C. vulgaris by extracting components that were effective in this procedure. In an experimental study, six various polysaccharides (RFPs, MAPs, UWPs, AEPs, HWPs and CEPs) were extracted from C. vulgaris using repeated freeze-thaw, microwave, ultrasonic waves, alkaline treatment, hot water and cellulose. Then, antioxidant activities of the extracts were assessed and it was concluded that alkaline extraction method followed by ultrasonic extraction included the highest efficiency in the production of crude polysacch-arides due to the complex and rigid cell walls of C. vulgaris. The polysaccharide extraction method was a key factor that affected the antioxidant activity of C. vulgaris poly-saccharides. Additionally, extracts achieved by ultrasoni-cation showed superior activities than those extracts achieved by other methods did [63].

  1. Conclusion

The present study demonstrated that the zebrafish model could be used as a tool for algae screening and the aqueous extracts of A. platensis and C. vulgaris with their antioxidant characteristics and biologically active compounds at conc-entrations of 31.25,7.81,1.95 and 125, 31.25, 7.81 and 1.95 μg.ml-1, respectively, could regenerate pancreatic β-cells. In addition, it could be concluded that these extracts were possibly effective in inhibiting the NF-κB pathway on β-cell regeneration and cell apoptosis. Since pure phycocyanin did not cause significant regeneration compared to the negative controls, this study demonstrated that compounds other than phycocyanins could be effective in regeneration of β-cells. Moreover, the present study demonstrated that the micro-algal extracts of A. platensis and C. vulgaris could be used in foods and medicines.

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

Investigation, T.H; supervision, F.H, Y.T; writing review and editing, T.H, M.R. All authors have read and agreed to the published version of the manuscript.

References

  1. Sathasivam R, Radhakrishnan R, Hashem A, Abd-Allah EF. Microalgae metabolites: A rich source for food and medicine. Saudi J Biol Sci. 2019; 26(4): 709-722.

https://doi.org/10.1016/j.sjbs.2017.11.003

  1. de Oliveira AP, Bragotto AP. Microalgae-based products: Food and public health. Future Foods. 2022; 6: 100157.

https://doi.org/10.1016/j.fufo.2022.100157

  1. Su M, Bastiaens L, Verspreet J, Hayes M. Applications of microalgae in foods, pharma and feeds and their use as fertilizers and biostimulants: Legislation and regulatory aspects for consideration. Foods. 2023; 12(20): 3878.

https://doi.org/10.3390/foods12203878

  1. Demarco M, de Moraes JO, Matos ÂP, Derner RB, de Farias Neves F, Tribuzi G. Digestibility, bioaccessibility and bioactivity of compounds from algae. Trends Food Sci Technol. 2022; 121: 114-128.

https://doi.org/10.1016/j.tifs.2022.02.004

  1. Ciferri O, Tiboni O. The biochemistry and industrial potential of Spirulina. Annu Rev Microbiol. 1985; 39(1): 503-526.

http://doi.org/10.1146/annurev.mi.39.100185.002443

  1. Vonshak A, Spirulina platensis Arthrospira: Physiology, Cell-Biology and Biotechnology. CRC press; 1997.
  2. Spolaore P, Joannis-Cassan C, Duran E, Isambert A. Commercial applications of microalgae. J Biosci Bioeng. 2006; 101(2): 87-96.

https://doi.org/10.1263/jbb.101.87

  1. Masojidek J, Torzillo G. Mass cultivation of freshwater microalgae. Encyclopedia of Ecology. Elsevier, Oxford. 2008. 2226-2235.

http://dx.doi.org/10.1016/B978-008045405-4.00830-2

  1. Safi C, Zebib B, Merah O, Pontalier PY, Vaca-Garcia C. Morphology, composition, production, processing and applications of Chlorella vulgaris: A review. Renew Sustain Energy Rev. 2014; 35: 265-278.

https://doi.org/10.1016/j.rser.2014.04.007

  1. Khandual S, Sanchez EO andrews HE, De la Rosa JD. Phycocyanin content and nutritional profile of Arthrospira platensis from Mexico: Efficient extraction process and stability evaluation of phycocyanin. BMC Chem. 2021; 15: 1-3.

https://doi.org/10.1186/s13065-021-00746-1

  1. Lopes G andrade PB, Valentao P. Phlorotannins: Towards new pharmacological interventions for diabetes mellitus type 2. Molecules. 2016; 22(1):56.

https://doi.org/10.3390/molecules22010056

  1. Zhu Y, Liu Q, Zhou Z, Ikeda Y. PDX1, Neurogenin-3 and MAFA: Critical transcription regulators for beta cell develop-ment and regeneration. Stem Cell Res Ther. 2017; 8: 1-7.

https://doi.org/10.1186/s13287-017-0694-z

  1. Cecil RL. On hypertrophy and regeneration of the islands of Langerhans. J Exp Med. 1911; 14(5): 500.

https://doi.org/10.1084/jem.14.5.500

  1. Singh A, Gibert Y, Dwyer KM. The adenosine, adrenergic and opioid pathways in the regulation of insulin secretion, beta cell proliferation and regeneration. Pancreatology. 2018; 18(6): 615-623.

https://doi.org/10.1016/j.pan.2018.06.006

  1. Lenzen S. Chemistry and biology of reactive species with special reference to the antioxidative defence status in pancreatic β-cells. Biochim Biophys Acta Gen Subj. 2017; 1861(8): 1929-1942.

https://doi.org/10.1016/j.bbagen.2017.05.013

  1. Mabhida SE, Dludla PV, Johnson R, Ndlovu M, Louw J, Opoku AR, Mosa RA. Protective effect of triterpenes against diabetes-induced β-cell damage: An overview of in vitro and in vivo Pharmacol Res. 2018; 137: 179-192.

https://doi.org/10.1016/j.phrs.2018.10.004

  1. Sathasivam R, Ki JS. A review of the biological activities of microalgal carotenoids and their potential use in healthcare and cosmetic industries. Marine Drugs. 2018; 16(1): 26.

https://doi.org/10.3390/md16010026

  1. Romay CH, Gonzalez R, Ledon N, Remirez D, Rimbau V. C-phycocyanin: A biliprotein with antioxidant, antiinflam-matory and neuroprotective effects. Curr Protein Pept Sc. 2003; 4(3): 207-216.

https://doi.org/10.2174/1389203033487216

  1. Mohamed ZA. Polysaccharides as a protective response against microcystin-induced oxidative stress in Chlorella vulgaris and Scenedesmus quadricauda and their possible significance in the aquatic ecosystem. Ecotoxicol. 2008; 17: 504-516.

https://doi.org/10.1007/s10646-008-0204-2

  1. Di Cristofano A. SGK1: the dark side of PI3K signaling. Curr Top Dev Biol. 2017; 123: 49-71.

https://doi.org/10.1016/bs.ctdb.2016.11.006

  1. Matsuda H. Zebrafish as a model for studying functional pancreatic β cells development and regeneration. Dev Growth Differ. 2018; 60(6): 393-399.

https://doi.org/10.1111/dgd.12565

  1. Al-Awar A, Kupai K, Veszelka M, Szucs G, Attieh Z, Murlasits Z, Torok S, Posa A, Varga C. Experimental diabetes mellitus in different animal models. J Diabetes Res. 2016; 2016(1): 9051426.

https://doi.org/10.1155/2016/9051426

  1. Ferahtia A, Halilat MT, Mimeche F, Bensaci E. Surface water quality assessment in semi-arid region (El Hodna watershed, Algeria) based on water quality index (WQI). Stud Univ Babes Bolyai Chem. 2021; 66(1): 127-142.

http://dx.doi.org/10.24193/subbchem.2021.01.10

  1. Sorokin C, Krauss RW. The effects of light intensity on the growth rates of green algae. Plant physiology. 1958; 33(2): 109.

https://doi.org/10.1104%2Fpp.33.2.109

  1. Choonawala BB. Spirulina production in brine effluent from cooling towers [Doctoral dissertation]. Durban University of Technology; 2007. 370 p.

https://doi.org/10.51415/10321/134

  1. Thiagarajan SK, Rama Krishnan K, Ei T, Husna Shafie N, Arapoc DJ, Bahari H. Evaluation of the effect of aqueous Momordica charantia Linn. extract on zebrafish embryo model through acute toxicity assay assessment. Evid Based Complement Alternat Med. 2019; 2019(1): 9152757.

https://doi.org/10.1155/2019/9152757

  1. Cha SH, Kim HS, Hwang Y, Jeon YJ, Jun HS. Polysiphonia japonica extract attenuates palmitate‐induced toxicity and enhances insulin secretion in pancreatic beta‐ Oxid Med Cell Longev. 2018; 2018(1): 4973851.

https://doi.org/10.1155/2018/4973851

  1. Kwei CK. Elucidation and isolation of specific bioactive compound in cyanobacteria isolates [Doctoral dissertation]. University of Adelaide, School of Chemical Engineering; 2012.

https://hdl.handle.net/2440/77345

  1. Dere S, GUNEŞ T, Sivaci R. Spectrophotometric determination of chlorophyll-A, B and totalcarotenoid contents of some algae species using different solvents. Turkish journal of Botany. 1998; 22(1): 13-18.

https://journals.tubitak.gov.tr/botany/vol22/iss1/3

  1. Yucetepe A, Saroglu O, Daşkaya Dikmen C, BilDik F, Ozçelik B. Optimisation of ultrasound-assisted extraction of protein from Spirulina platensis using RSM. Czech J Food Sci. 2018; 36(1): 98-108

https://doi.org/10.17221/64/2017-CJFS

  1. Chia SR, Chew KW, Zaid HF, Chu DT, Tao Y, Show PL. Microalgal protein extraction from Chlorella vulgaris FSP-E using triphasic partitioning technique with sonication. Front Bioeng Biotechnol. 2019; 7: 396.

https://doi.org/10.3389/fbioe.2019.00396

  1. Silve A, Papachristou I, Wüstner R, Sträßner R, Schirmer M, Leber K, Guo B, Interrante L, Posten C, Frey W. Extraction of lipids from wet microalga Auxenochlorella protothecoides using pulsed electric field treatment and ethanol-hexane blends. Algal Res. 2018; 29: 212-222.

https://doi.org/10.1016/j.algal.2017.11.016

  1. Safafar H, Van Wagenen J, Møller P, Jacobsen C. Carotenoids, phenolic compounds and tocopherols contribute to the antioxidative properties of some microalgae species grown on industrial wastewater. Marine drugs. 2015;13(12): 7339-7356.

https://doi.org/10.3390/md13127069

  1. Maryam S, Razak R, Baits M, Salim AF. Analysis of vitamin C and antioxidant activity of Capsicum frutescens L. and Capsicum annuum L. Indon J Pharm Sci Technol. 2023: 57-64.

https://doi.org/10.24198/ijpst.v0i0.46082

  1. Hatami T, Emami SA, Miraghaee SS, Mojarrab M. Total phenolic contents and antioxidant activities of different extracts and fractions from the aerial parts of Artemisia biennis willd. Iran J Pharm Res. 2014; 13(2): 551.

https://doi.org/10.22037/ijpr.2014.1518

  1. Kumar M, Kulshreshtha J, Singh GP. Growth and biopigment accumulation of cyanobacterium Spirulina platensis at different light intensities and temperature. Braz J Microbiol. 2011; 42: 1128-1135.

https://doi.org/10.1590%2FS1517-838220110003000034

  1. Babu M, Ashok K, Senthil J, Kalaiyarasu T. Effect of pH on Arthrospira platensis Alochana Chakra Journal. IX (V). 2020: 1-0.
  2. Pandey JP, Pathak N, Tiwari A. Standardization of pH and light intensity for the biomass production of Spirulina platensis. J Algal Biomass Utln. 2010; 1(2): 93-102.
  3. Sornchai P, Iamtham S. Effects of different initial pH of modified zarrok medium on large-scale Spirulina maxima Journal of Medical and Bioengineering. 2013; 2(4): 266-269.

http://dx.doi.org/10.12720/jomb.2.4.266-269

  1. Tayebati H, Shariati FP, Soltani N, Tehrani HS. The effect of different light variables on spirulina growth and its component. Proceeding of the The 11th International Chemical Engineering Congress & Exhibition; 2020 15-17; Fouman, Iran.

https://www.researchgate.net/publication/345775863

  1. Adenan NS, Yusoff FM, Shariff M. Effect of salinity and temperature on the growth of diatoms and green algae. Journal of Fisheries and Aquatic Science. 2013; 8(2): 397.

http://dx.doi.org/10.3923/jfas.2013.397.404

  1. Suthar S, Verma R. Production of Chlorella vulgaris under varying nutrient and abiotic conditions: A potential microalga for bioenergy feedstock. Process Saf Environ Prot. 2018; 113: 141-148.

https://doi.org/10.1016/j.psep.2017.09.018

  1. Seghiri R, Kharbach M, Essamri A. Functional composition, nutritional properties and biological activities of Moroccan Spirulina J Food Qual. 2019; 2019(1): 3707219.

https://doi.org/10.1155/2019/3707219

  1. Manrich A, de Oliveira JE, Martins MA, Mattoso LH. Physicochemical and thermal characterization of the Spirulina platensis. Journal of Agricultural Science and Technology B. 2020; 10: 298-307.

http://dx.doi.org/10.17265/2161-6264/2020.05.004

  1. Babadzhanov AS, Abdusamatova N, Yusupova FM, Faizullaeva N, Mezhlumyan LG, Malikova MK. Chemical composition of Spirulina platensis cultivated in Uzbekistan. Chem Nat Compd. 2004; 40(3).

https://doi.org/10.1023/B:CONC.0000039141.98247.e8

  1. Gorjizadeh H, Sakhaei N, Doustshenas B, Ghanemi K, Arch-angi B. Fatty acid composition of Spirulina sp., Chlorella sp. and Chaetoceros sp. microalgae and introduction as potential new sources to extinct omega 3 and omega 6. Iran South Med J. 2016; 19 (2): 212-224.

http://dx.doi.org/10.18869/acadpub.ismj.19.2.212

  1. Vickers NJ. Animal communication: when i’m calling you, will you answer too? Curr Biol. 2017; 27(14): R713-5.

http://dx.doi.org/10.1016/j.cub.2017.05.064

  1. Muthuraman P, Senthilkumar R, Srikumar K. Alterations in beta-islets of Langerhans in alloxan-induced diabetic rats by marine Spirulina platensis. J Enzyme Inhib Med Chem. 2009; 24(6): 1253-1256.

https://doi.org/10.3109/14756360902827240

  1. Pandurangan M, Kim DH. Therapeutic potential of cyano-bacteria against streptozotocin-induced diabetic rats. 3 Biotech. 2016; 6(1): 1-7.

https://doi.org/10.1007/s13205-016-0411-0

  1. Lee J, Park A, Kim MJ, Lim HJ, Rha YA, Kang HG. Spirulina extract enhanced a protective effect in type 1 diabetes by anti-apoptosis and anti-ROS production. Nutrients. 2017; 9(12): 1363.

https://doi.org/10.3390/nu9121363

  1. Kulkarni AA, Conteh AM, Sorrell CA, Mirmira A, Tersey SA, Mirmira RG, Linnemann AK anderson RM. An in vivo zebrafish model for interrogating ROS‐mediated pancreatic β‐cell injury, response and prevention. Oxid Med Cell Longev. 2018; 2018(1): 1324739.

https://doi.org/10.1155/2018/1324739

  1. Gouda W, Mageed L, Abd El Dayem SM, Ashour E, Afify M. Evaluation of pro-inflammatory and anti-inflammatory cytokines in type 1 diabetes mellitus. Bull Natio Res Centre. 2018; 42: 1-6.

https://doi.org/10.1186/s42269-018-0016-3

  1. DiDonato JA, Mercurio F, Karin M. NF‐κB and the link between inflammation and cancer. Immunol Rev. 2012; 246(1): 379-400.

https://doi.org/10.1111/j.1600-065X.2012.01099.x

  1. Hayden MS, Ghosh S. NF-κB in immunobiology. Cell Res. 2011; 21(2): 223-244.

https://doi.org/10.1038/cr.2011.13

  1. Oeckinghaus A, Hayden MS, Ghosh S. Crosstalk in NF-κB signaling pathways. Nat Immunol. 2011; 12(8): 695-708.

https://doi.org/10.1038/ni.2065

  1. Zhang JM, An J. Cytokines, inflammation and pain. Int Anesthesiol Clin. 2007; 45(2): 27-37.

https://doi.org/10.1097/aia.0b013e318034194e

  1. Cnop M, Welsh N, Jonas JC, Jorns A, Lenzen S, Eizirik DL. Mechanisms of pancreatic β-cell death in type 1 and type 2 diabetes: many differences, few similarities. Diabetes. 2005; 54 (suppl 2): S97-107.

https://doi.org/10.2337/diabetes.54.suppl_2.S97

  1. Takyar MB, Khajavi SH, Safari R. Evaluation of antioxidant properties of Chlorella vulgaris and Spirulina platensis and their application in order to extend the shelf life of rainbow trout (Oncorhynchus mykiss) fillets during refrigerated storage. Lwt. 2019; 100: 244-249.

https://doi.org/10.1016/j.lwt.2018.10.079

  1. Gabr GA, El-Sayed SM, Hikal MS. Antioxidant activities of phycocyanin: A bioactive compound from Spirulina platen-sis. J Pharm Res Int. 2020; 32(2): 73-85.

https://doi.org/10.9734/jpri/2020/v32i230407

  1. Ahmadi F, Kadivar M, Shahedi M. Antioxidant activity of Kelussia odoratissima in model and food systems. Food Chem. 2007; 105(1): 57-64.

https://doi.org/10.1016/j.foodchem.2007.03.056

  1. Zarandi-Miandoab L, Pouriossef F, Razavi S F, Chaparzadeh N. Phycocyanin, as a cyanobacterial antioxidant: Structure, function and applications. J Plant Proc Func. 2022; 10(1): 1-22.

http://jispp.iut.ac.ir/article-1-1579-fA. html

  1. Anwer SS, Sdiq KH, Muhammad KR, Aladdin LM. Phenolic compound and fatty acid properties of some microalgae species isolated from Erbil city. Braz J Biol. 2022; 82: e256927.

https://doi.org/10.1590/1519-6984.256927

  1. Yu M, Chen M, Gui J, Huang S, Liu Y, Shentu H, He J, Fang Z, Wang W, Zhang Y. Preparation of Chlorella vulgaris polysaccharides and their antioxidant activity in vitro and in vivo. Int J Biol Macromol. 2019; 137: 139-50.

https://doi.org/10.1016/j.ijbiomac.2019.06.222

 

 

 

 

 

Bacillus Multi-strain from Malaysian Fish Sauces Demonstrating Proteolytic, Lipolytic, Esterolytic and Glutamic-acid Production Activities

Shanti Dwita Lestari, Norhayati Hussain, Anis Shobirin Meor Hussin, Shuhaimi Mustafa, Yun Shin Sew

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e26
https://doi.org/10.22037/afb.v11i1.45507

Background and Objective: Aroma and taste of fish sauce are derived from complex metabolic reactions involving bacteria and enzymes that degrade proteins and lipids. A longer fermentation time is needed to fully develop the rich flavor. The objective of this study was to isolate halotolerant bacteria from Malaysian fermented fish sauce that demonstrated significant proteolytic, lipolytic, esterolytic and glutamic acid-accumulating activities. These bacteria might potentially be used as starting cultures to enhance development of flavors during fish sauce fermentation.

Material and Methods: The initial screening on proteolytic activity was carried out on saline skim milk agar. Isolates with high proteolytic index and positive lipase/esterase activity were further assessed using casein-based protease activity assay. Protease and lipase activities under various conditions of strains, NaCl concentrations (20–30% w/v), temperatures (30–35 °C) and incubation times (0–120 h) were assessed and analyzed using four-way ANOVA. The p-nitrophenyl butyrate and colorimetric assays were used to determine esterase and glutamic acid accumulating activities, respectively.

Results and Conclusion: Six strains isolated from budu demonstrated hydrolytic activities and identified as Bacillus spp. Proteolytic activities were averagely highest in B. licheniformis 12N3A at 25% NaCl, 30 °C and 96 h of incubation. The highest lipolytic activities were achieved with B. haikouensis 12M1F at 30% NaCl, 35 °C and 72 h of incubation. Bacillus sp. 3M3A showed the highest esterase activity of 155.48 U, while Bacillus sp. 6M2A had the highest glutamic acid accumulation at 1993.02 mol. l-1. The strains of this study have demonstrated appropriateness for use as a cocktail culture to accelerate the fermentation process and enhance the flavor profile of fish sauces. Halotolerant nature of the strains and enzymes supports their potentials for wider use in the food industry.

Conflict of interest: The authors declare no conflict of interest.

  1. Introduction

 

Budu is a Malaysian traditional fish sauce made from anchovies fermented with salt for 6–12 m and officially recognized as a national culinary heritage. Flavor is addressed as the primary quality attribute of budu. Function prediction of budu microbial communities based on meta-genomic composition has demonstrated increased protein and lipid breakdown pathways during fermentation and these pathways are known to play critical roles in formation of flavor [1]. Through spontaneous fermentation of high-salt fish sauce, a wide range of taste and aroma-active compounds belonging to aldehydes, acids, esters, alcohols and pyrazines are gradually formed, including 2-methyl-butanal, 3-methylbutanoic acid, methyl 2-ethyldecanoate, 1-octen-3-ol and 2,6-dimethylpyrazine [1]. This is achieved through the combined activities of fish endogenous enzymes and metabolic activities of halophilic and halotolerant microbes [2]. Additionally, microbes are capable of produc-ing microbial volatile organic compounds, which may stimulate production of secondary metabolites, especially during co-cultures [3]. Fatty acids, peptides and amino acids that are released through the process of lipid and protein hydrolyses serve as precursors for aroma compounds. They can be transformed into volatile organic compounds, including aldehydes, esters, ketones, alcohols, furans, hydrocarbons, lactones, pyrazines, amines, phenols, indoles, acids and sulfur-containing compounds [4]. The medium and short-chain fatty acid esters are important volatile organic compounds that can impart pleasant fruity flavors and aromas [5] and their presence in fish sauce can cover unpleasant smells and off flavors contributed by protein-derived compounds such as dimethyl trisulfide and trimethylamines. Microorganisms involved in fish sauce fermentation may facilitate glutamic acid accumulation by converting ketoglutaric acid into L-glutamic acid under the function of glutamate synthetase or glutamic acid dehydro-genase, as well as hydrolysis of proteins into umami amino acids and peptides [6]. Figure 1 shows schematic functions of protease, lipase and esterase as well as formation of glutamic acid in fermentation of fish sauces.

At the onset of fermentation, fermentation-assisting bacteria are not the prevailing microorganisms. They need longer times to adapt to high salinity, establish dominance in the microbial community and produce flavor compounds [7].  Consequently, a prolonged fermentation time is needed to produce rich, flavorful fish sauces. The extended fermentation time can lead to an increase in overall produc-tion time, which may not be desirable for the producers who try to meet market demand and generate revenue quickly. In response to this, Malaysian fish-sauce producers terminate their fermentation process after only three months even though the flavor has not fully developed. Accelerating the fermentation process is therefore important for the production efficiency and profitability of fish sauce industries.

Use of starting cultures has been suggested as an effective method to enhance proteolysis during fish-sauce fermentation [8], while improving and maintaining the consistent quality of the fermented fish [9]. Addition of Marinococcus halotolerans SPQ isolated from salt crystals showed increased contents of aspartic and glutamic acids with several aroma compounds belonged to alcohol group [10]. Use of protease-producing Tetragenococcus halophi-lus has decreased fermentation time to six months and improved quantity of desirable amino acids [11]. When selecting starter cultures for fish-sauce fermentation, ease of cultivation is primarily important. It is essential for the strains to possess pro-technological metabolic character-istics such as the ability to grow and produce high-activity hydrolases that are active at high salt concentrations (20–30% NaCl).

Therefore, a candidate derived from fish sauce is an excellent choice due to its adaptability, resistance to osmotic stress and ability to thrive in high salt environments. This enables them to grow more efficiently and fulfil their roles within the microbial community.

Fermentation of fish, which naturally contains high protein and low sugar contents, differs significantly from conventional carbohydrate fermentation. Rather than targeting sugars, this process focuses majorly on fish protein and lipid components [12]. Therefore, proteolytic and lipolytic activities are two key characteristics that should be addressed when selecting starter candidates for fish fermentation. Release of proteases and lipases by halophilic Staphylococcus simulans PMRS35 and Haloarcula sp. isolated from salted and fermented fish [13,14] as well as M. halotolerans SPQ and Chromohalobacter sp. from salt environments [10,15] has been documented in several investigations. It is suggested that fish sauce contains a diverse enzymes-producing microbiota that contribute to the formation of taste-active compounds, making it an ideal source for the selection of starter cultures. Nevertheless, a complete assessment of various strains from budu has not been carried out, specifically for assessing production of multiple enzymes that are likely to improve budu flavor. The aim of the current study was to isolate, identify and assess bacterial cultures from budu, displaying proteolytic, lipolytic, esterolytic and glutamic-acid accumulating activities. This study provides a novel contribution to the existing literature as it assessed the bacterial enzymes involved in the flavor development of Malaysian fish sauce, an area with limited attentions. Halotolerant strains thoroughly assessed for their major abilities to degrade fish proteins and lipids make promises for potential uses in the food industry. They can provide a viable solution for improving production and fermentation of high-salt fermented foods, particularly fish sauces.

  1. Materials and Methods

2.1. Isolation of halotolerant proteolytic bacteria

Fish-sauce samples from 3, 6 and 12-m fermentation tanks were used for bacterial isolation. A modified isolation approach [8] was used to concurrently identify halotolerant proteolytic bacteria during first screening. To increase the likelihood of collecting indigenous proteolytic fish-sauce origin strains, media types and salt concentrations were modified. Twenty-five grams of fish sauce were diluted with 225 ml of sterile 0.85% (w/v) NaCl and stirred for 1 min. To recover further halophilic species, three decimal dilutions of the samples were plated on four media of marine agar (MA) with 20% NaCl for bacteria tolerant to 20% NaCl; De Man, Rogosa and Sharpe agar (MRSA) with 20% NaCl for 20% NaCl-tolerant lactic acid bacteria (LAB); mannitol salt agar (MSA) with 10% NaCl for salt-tolerant Staphylococci; and nutrient agar (NA) with 30% NaCl for bacteria tolerant to 30% NaCl. Each medium received 1% of skim milk for proteolytic activity screening. The agar medium was incubated at 30 °C for 3–14 d until colonies formed. Four-quadrant streaking pattern was used to pick and streak clear zone-forming bacterial colonies with diverse morphologies onto newly prepared agar plates for purification.

2.2. Screening of protease and lipase/esterase activities using agar plate assay

Prior to the screening, one loop of every single isolate was transferred to marine broth (MB) containing 20% NaCl and incubated at 30 °C for 3 d, except for colonies recovered from MSA that were grown in nutrient broth supplemented with 10% NaCl. Cells were collected by centrifugation at 4000 rpm for 10 min at 4 °C following a 3-d incubation time. To prepare pellets for resuspension, pellets were first rinsed twice with 10 ml of pH-7.4 phosphate buffered saline (PBS). For each strain, absorbance of the suspended cells at 600 nm was adjusted to 0.85 before well-diffusion method was used. For the screening of bacteria with proteolytic activity, aliquots of the bacterial suspension (50 µl) were added to a 6-mm well on agar media consisted of NA supplemented with 10% NaCl and 1% skim milk for MSA-derived strains and MA supplemented with 1% skim milk for the rest of strains. Proteolytic indices were assessed after incubating plates at 30 °C for 2 d [9]. Agar spot techniques in three various media of phenol red, tributyrin and Tween 80 agar were used to screen bacteria that produced lipase or esterase. Each medium was prepared according to [16]. Five microliters of resuspended cells were dropped onto the surface of the phenol red, tributyrin and Tween 80 agar and allowed to absorb. Inoculated plates were incubated at 30 °C for 3–14 d until visible signs of lipolysis activity were observed. The color shift of phenol-red agar from red to orange indicated lipase activity, which was caused by a slight pH drop induced by fatty acid releases. A clear zone on tributyrin agar indicated the presence of extracellular esterase. The FFAs were precipitated by calcium (giving a white zone) around colonies showing lipase and esterase activity on Tween 80 agar. Isolates demonstrating a high proteolytic index and/or indicating lipolytic activity were selected for further growth and protease activity assessment using liquid assay.

2.3. Growth assessment of the strains

One loop of each selected strain was transferred to MB media and incubated at 30 °C for 48 h. After incubation, cells were centrifuged at 4000 rpm for 10 min at 4 °C. Collected pellets were washed and resuspended in PBS with an OD600 adjusted to 1.1-1.2. A 1-ml volume of the cell suspension was transferred to 40 ml of MB using 125-ml amber bottles. The mixture was incubated at 30 °C with 120-rpm agitation speed. Growth assessment was carried out by measuring aliquots of the growth media at 600 nm using Biomate 3 UV-vis spectrophotometer (Thermo-Fisher Scientific, Massachusetts, USA) at specified intervals for 216 h. Sterile MB medium was used as blank for each reading.

2.4. Extraction of the bacterial crude enzymes

Cell-free supernatant (CFS) was prepared for the enzyme assays by centrifuging aliquots of the harvested growth media at 11,000 × g for 10 min at 4 °C.

2.5. Assessment of protease activity

Protease activity of the isolates was determined based on the Cupp-Enyard and Aldrich method [17], where casein was used as substrate. Casein was diluted to 6.5 mg.ml-1 in 50 mM potassium phosphate buffer (pH 7.5). Temperature of the solution gradually increased to 80–85 °C with gentle stirring for nearly 10 min until a homogeneous dispersion was achieved. Casein solution was set at 37 °C prior to use. Moreover, CFS was added to 5 ml of casein solution and incubated at 37 °C for 10 min. Every tube was then treated with 5-ml solution of 110 mM trichloroacetic acid (TCA) following incubation to terminate the reaction. To verify that each tube had an identical end volume and account for the enzyme absorbance value, an equal quantity of the enzyme solution was added to the blank. Solutions were incubated at 37 °C for 30 min and then centrifuged at 4000 rpm for 5 min to remove insoluble substances. For colori-metric determination of tyrosine, 400 µl of the supernatant were immediately added with 1 ml of sodium carbonate and 0.2 ml of Folin reagent. The mixture was mixed gently and permitted to stabilize at 37 °C for 30 min. Absorbance measurement was carried out at 660 nm using spectrophoto-meter. Tyrosine concentration was determined using standard tyrosine curve. Bacterial protease unit (U) was defined as the quantity of enzyme that produced the equivalent of 1 μmol. L-1 of L-tyrosine per min in pH 7.5 and 37 °C. Isolates with significant protease activity were subjected to further analyses. The protease activity was determined using the Eq. 1

  Eq.1

2.6. Effects of time, temperature and NaCl concentration on protease and lipase activities

Using MB media, the selected strains were assessed for their protease and lipase activities under various temperatures (30 and 35 °C) and NaCl concentrations (20, 25 and 30%). In this study, a temperature range of 30–35 °C was selected as it represented the average temperature used in the industry. Salt concentration varied 20–30% during budu 12-m fermentation; therefore, this salt range was used to assess its effects on the strains’ enzyme activity. Protease assay was carried out using the method described in Section 2.5. To assess lipolytic activity, titration method [18] was used with emulsion of fish oil and polyvinyl alcohol at a ratio of 1:3 as the substrate for the assay. Briefly, 2.5 ml of phosphate buffer (pH 4.8) were added to 2.5 ml of the substrate, followed by adding 0.5 ml of CFS. A 10-min enzymatic reaction was carried out at 37 °C. Blank was prepared without addition of CFS. A final volume of 7.5 ml of 95% ethanol was added to terminate the reaction. Phenolphthalein indicator was used to titrate the released fatty acids against 0.1 M NaOH. The quantity of lipase that might release 1 µmol of fatty acids was measured in units of lipase activity. The mole of fatty acids was equal to the mole of the titrant and 1 mol NaOH was equal to 106 × µmol fatty acid equivalent. Lipase activity was determined using the Eqs. 2 and 3:

 

Eq. 2

Eq. 3

2.7. Esterase activity

Colorimetric method was used to determine the esterase activity using modified method [19, 20]. Prior to esterase assessment, an overnight culture (24 h) of each strain was grown in modified Gibbon’s media containing 20% of NaCl, 2.5% of fish oil, 0.1% of MgSO4.7H2O, 0.3% of Na3C6H5O, 0.2% of KCl, 0.75% of tryptone and 0.1% of yeast extract for 3 d at 30 °C and 120 rpm. The CFS was used for the analysis. A mixture of 14 mM p-nitrophenyl butyrate in acetonitrile, 66.67 mM of Tris HCl (pH 8) and 3M of NaCl at a ratio of 1:8:1 was prepared as the substrate for the esterase activity assay. A volume of 20 µl of CFS and 200 µl of substrate were transferred into 96-well microplates and gently agitated. Double-distilled water was used as blank instead of CFS. Absorbance reading was carried out at 410 nm every 30 s at 37 °C over 5 min to measure the p-nitrophenol (p-NP) release using microplate reader (Powerwave X 340 microplate scanning spectro-photometer, BIO-TEK Instruments, Vermont, USA). Extinction coefficient (ε) for p-NP of this assay was 8222.1 M-1 cm-1, which was derived from the slope of the p-NP standard curve under similar detection conditions. For one unit (U) of esterase activity, enzyme quantity needed to release 1 µM of p-NP per minute was calculated based on Eq. 4 and Beer-Lambert Law as follows:

 

                                                                                                                                                                                                                             Eq. 4

Where, ΔAbs showed changes in absorbance over time; ε denoted the molar extinction coefficient in M-1 cm-1; volume of assay represented the total volume of reaction mixture (ml); and Δt represented the incubation time (min).

2.8. Glutamic acid assessment

Prior to assessment, the overnight culture of each strain was inoculated (1% v/v) into the glutamic acid production media (pH 7). This medium consisted of 5% of glucose, 0.8% of urea, 0.0002% of biotin, 0.1% of K2HPO4, 0.25% of MgSO4.7H2O, 0.01% of MnSO4.7H2O and 0.16% of CaCO3. Incubation was carried out at 30 °C for 7 d at 120 rpm. The crude glutamic acid source was the CFS that separated following centrifugation at 10,000 rpm for 10 min at 4 °C [21]. Glutamic acid was determined using glutamic acid colorimetric assay kit (Elabscience Biotechnology, Texas, USA).

2.9. Genome-based identification of the isolates

Extraction of the bacterial DNA was carried out using Nucleospin microbial DNA extraction kit (Machery-Nagel, Duren, Germany). One loop of a single bacterial colony was pelleted and transferred to a microcentrifuge tube containing 40–400 μm of glass beads, added with buffer and proteinase and processed with FastPrep-24 system (MP Biomedicals, Ohio, USA). Lysed cells were centrifuged at 11,000× g for 30 s and DNA in the supernatant was purified using microbial DNA column based on the manufacturer’s protocol. Genome-based identification of the strains was carried out using Patriot Biotech, Selangor, Malaysia, based on the manufacturer’s standard protocol. Primers of 27F (TTTCTGTTGGTGCTGATATTGCAGRGTTYGATYMTGGCTCAG) and 1492R (ACTTGCCTGTCGCTCTAT-CTTCTACGGYTACCTTGTTACGACTT) with a Nano-pore partial adapter on the 5' end were used to amplify 16S rRNA full-length sequence of the strains. The PCR was carried out using WizBio HotStart 2× mastermix (Wizbiosolutions, Gyeonggi-do, Korea) with the following conditions of an initial denaturation step at 95 °C for 3 min; followed by 35 cycles of denaturation at 95 °C for 20 s, annealing at 50 °C for 20 s and extension at 72 °C for 120 s. The PCR products were visualized on agarose gels and purified using solid-phase reversible immobilization beads. Nanopore Flongle flow cell (Oxford Nanopore Technol-ogies, Oxford, UK) was used for the 24-h sequencing process. Sequences were compared to known sequences using BLAST online tool of the National Centre for Biotechnology (NCBI) website to verify the homology. The neighbor-joining trees were then constructed using MEGA 11 software. The rRNA sequence data of the selected strains were submitted to GenBank database.

2.10. Statistical analysis

Minitab 19 statistical package (Minitab, Pennsylvania, USA) was used for the analysis. Results of the ANOVA analysis was reported statistically significant when p < 0.05. One-way ANOVA was carried out on variables to detect significant differences between the samples. Four-way ANOVA was used to assess effects of the multiple factors (time, temperature, NaCl concentration and strain) on the protease and lipase activities. To find out which groups of the samples were distinct from others, post hoc Tukey's honest significant difference (HSD) test was carried out.

2.11. Ethical considerations

No experiments involving humans or animals were carried out in this study.

  1. Results and Discussion

3.1. Initial screening and isolation of proteolytic and lipolytic halotolerant bacteria

For selecting bacteria for budu starter cultures, strains were initially assessed based on their ability to persist high-salt concentrations associated with budu fermentation. A total of 50 bacterial isolates were capable of growing on isolation media supplemented with 10–30% of NaCl (w/v) (data not shown). Twenty-nine isolates were originated from 12-m samples, eight from 6-m samples and 13 from 3-m samples. Only five isolates were recovered from NA containing 30% of NaCl, while 40 isolates were recovered from MA (20% NaCl). No colonies were observed in the MRSA containing 20% of NaCl, whereas, a few staphylococci were detected on MSA with 10% of NaCl. Decreased number of strains recovered from budu when grown on high-salt media could be due to the inactivation of key enzymes for microbial metabolism and growth. Additi-onally, the osmotic stress and metabolic adaptation forced bacteria to allocate their energy for adaptation rather than multiplication. Under further severe conditions, bacteria might enter viable but nonculturable (VBNC) states [22]. In a previous study, LAB and halophilic bacteria were isolated from Vietnamese fish sauces using salt concentrations ranging 5-18 and 18-25%, respectively. No growth of colonies was detected in high-salt media (approximately 29% NaCl) [10]. In the present study, strains capable of growing at 30% NaCl could be recovered; however, a longer incubation time of 14 d was needed for the colonies to become visible in the media, in contrast to the growth on MA that occurred within 72 h.

Presence of LAB has been reported in Thai and Japanese fish sauces [11, 23]; however, none of this group was recovered from budu when plated on MRSA containing 20% of NaCl. Absence of LAB growth in this media was because a majority of LAB grew best at a NaCl concen-tration of less than 10%, except for a few species in Tetrage-nococcus genus. All the 50 salt-tolerant bacteria from the initial screening could produce zones of hydrolysis surrounding colonies to various degrees, ranging 1.3-4.1 cm when grown on skim milk agar. However, only a few strains demonstrated lipase/esterase activities on phenol red, tributyrin and Tween 80 agar (data not shown). Figure 2 shows growth of colonies on various solid media during the initial screening of protease and lipase activities.

Twelve out of 50 isolates (Table 1), which selected based on the proteolytic index and qualitative lipase/esterase activity, were assessed for growth curve and protease activity using casein-based protease activity assay.

3.2. Growth assessment and screening of the protease activity using liquid assay

In Figure 3, growth curve and protease activity of 12 different strains are shown. Strains entered the lag phase from 0–6 h and the log phase from 6–24 h. From 24 h, stationary phase was occurred.

A combined timeline of the growth curve and protease activity indicated that protease was highly produced during the early to mid-stationary phases. Findings were similar to those from previous reports [24]; in which, Bacillus subtilis and B. siamensis demonstrated peaked protease activities during the stationary phase of bacterial growth. The logarithmic growth phase was observed within 12–24 h for all the strains. This phase was characterized by rapid division and growth of bacteria, which needed nutrients and energy for protein synthesis and cell replication. This led to upregulation of protease synthesis to assist in protein degradation and amino acids production for cellular metabolism. Stress caused by carbon and nitrogen depletion might contribute to the high production of proteolytic enzymes during the stationary phase [25].

Out of the 12 strains, 12N3A demonstrated the highest protease activity reaching 412.5 U within 72 h, which corresponded to the mid-stationary phase. This budu strain proteolytic activity was higher than that of B. subtilis isolated from natto, a fermented soybean, which ranged 122.64–280.90 U after 24 h of incubation [26]. The six strains with the highest proteolytic activity were then assessed for their lipolytic and proteolytic activities under various growth conditions.

3.3. Effects of incubation time, temperature and salt concentration on the strain protease activity

Figure 4 shows dynamics of protease activity of six selected strains of 3M2G, 3M3A, 6M1C, 6M2A, 12M1F and 12N3A.

Figure 4 illustrates that 6M1C, 6M2A and 12M1F achieved their highest protease activity at 96 h with the values of 161.82 U, 164.78U and 144.99 U, respectively.  In contrast, the highest protease activities of 3M2G, 3M3A and 12N3A strains were reached after 48 h with the respective values of 158.27 U, 140.51 U and 177.21. Significant effects of incubation time, temperature, NaCl, strain and their interactions on the protease activity (p < 0.05) were verified based on Tukey's HSD post hoc test that was carried out following four-way ANOVA. With an average value of 102.59 U, protease activity reached its highest point after 96 h of incubation. For temperature, the highest protease activity of all strains for all the factors was reached at 30 °C. Temperature fluctuation is one of the most common

environmental conditions during budu fermentation in Malaysia, which is generally carried out in open-air environments. The internal fermentation temperatures for budu range 30–35 °C while in Korean fish-sauce production, 30 °C is an ideal temperature for fermentation [27]. Budu isolates are typically adapted to grow in high-salt environments as they have developed mechanisms to tolerate excessive NaCl concentrations. Salt concentrations of 25% were optimum for enhanced protease activities of budu isolates, followed by 30% of NaCl. The NaCl concentrations up to 20% increased the Virgibacillus sp. SK37 extracellular protease activity [28]. The two strains of 12N3A and 6M2A produced the highest levels of proteases overall, indicating that protease activities were strain-specific. Adaptive variations in the environment, genetic variations of the protease-producing genes and differences in gene expression regulation might explain differences in the ability to produce proteases between the isolates [29].

3.4. Effects of incubation time, temperature and salt concentration on the strain lipase activity

Figure 5 illustrates the strain lipolytic activities at various temperatures and NaCl concentrations over 120-h of the growth time.

A four-factor ANOVA (time, temperature, NaCl concentration and strain) indicated significant positive correlations between all factors and their interactions and protease activity (p < 0.05). The greatest lipase activity was seen after 72 h of growth, as shown by Tukey's HSD pairwise comparison with time as a factor with an overall mean value of 12.58 U. This activity did not differ significantly from that of 24 h (11.92 U), which was the second highest lipase activity. The high lipolytic activity in the early stage of stationary phase (24–72 h) was possibly correlated with the glucose depletion in the growth media following the microbial rapid growth during the log phase, which resorted use of carbon source from glucose to lipids; hence, activating the lipase activity. Tukey's HSD pairwise comparison showed a generally higher lipase activity at 35 °C than 30 °C. Findings of this study were similar to the findings of a previous study, which reported significant decreases in lipase activity, when temperature increased from 25 to 40 °C [30]. Lipolytic activity was the highest at 30% NaCl and no significant differences were observed between this concentration and 20% NaCl. Despite secretion by similar strains, lipase and protease activities

could have various optimum temperatures and salt concentrations, as observed in this study. Differences were possibly caused by the fact that enzymes are proteins and each protein has its own structure, allowing it to react differently to external factors such as NaCl and temperature. Overall, 12M1F and 3M2G strains presented the highest crude lipase activities with the values of 10.91 and 10.67 U, respectively. A B. subtilis FS2 strain of Vietnamese fish-sauce origin was reported to secrete enzymes with lipase A activity when assessed on 0.1% tributyrin agar [31].

3.5. Esterase activity

Table 2 shows that esterase activity of the strains from budu ranged 97.47–155.48 U with 3M3A strain demonstrated the highest esterase activity (155.48 U), followed by 12M1F and 6M2A strains. Differences in the activity were strain specific and could be affected by genetic variations and gene expression of each strain. The esterase activity of halotolerant Salimicrobium sp. was initially detected during the mid-exponential growth phase (16–28 h) and reached to its peak at 24 U.ml-1 in the stationary phase (30–48 h) [32]. The pattern closely resembled activities of the protease and lipase in the current study. Bacillus licheniformis was reported to have its maximum esterase activity after 24 h of incubation [33]. A maximum specific esterase activity of 21.23 U.mg-1 was seen for Bacillus sp. JR3, using p-nitrophenyl butyrate as substrate [34]. Similar to previous findings [35], all the six halotolerant budu isolates displayed combined hydrolytic activities as they were capable of producing proteases, lipases and esterases.

3.6. Glutamic-acid production activity

Glutamic acid, which contributes to fish-sauce umami flavor, can be produced via bacterial metabolism and protein degradation. Glutamic-acid accumulation abilities of the strains in the specific growth media are present in Table 2. Glutamic acid concentrations produced by the six strains ranged 902.33–1993.02 µmol. l-1. Using glucose as fermentation substrate, strains of 6M2A, 12N3A, 6M1C, 12M1F and 3M2G produced higher glutamic acid concentrations than that Lactobacillus plantarum strain MNZ isolated from fermented foods did, whose activity was 1.032 mmol.l-1[36]. Technically, gdh gene has been identified in Bacillus sp., which is responsible for producing glutamic acid [37]. Glutamic acid decarboxylase in B. megaterium (BmGAD) are capable of accumulating L-glutamic acid at pH 5 with a specific activity of approximately 150 U.mg-1[38].

3.7. Strain identification

The 3M2G, 6M1C, 6M2A, 12M1F and 12N3A strains showed the highest homology of more than 99% with B. haikouensis, Bacillus sp. V3, Bacillus sp. V3, B. haikouensis and B. licheniformis, respectively, indicating that species-level identification was achieved. In contrast, 3M3A strain demonstrated 97.23% homology with B. licheniformis, suggesting that this strain belonged to Bacillus genus; thus, Bacillus sp. 3M3A was proposed for this strain. Sequencing data for each strain were deposited in GenBank under the following reference nos. of OQ642133, OQ642134, OQ642135, OQ642136, OQ642137 and OQ642138. Complete 16S rRNA gene sequences of all isolates were phylogenetically analyzed. Results (Figure 6) demonstrated that 12N3A and 3M3A isolates shared similarities with a variety of B. licheniformis strains. For genetic relatedness, 6M2A and 6M1C strains were closely linked to B. haikouensis, Rossellomorea aquimaris and R. vietnamensis. Bacillus haikouensis is an anaerobic halotolerant bacterium that was initially discovered from paddy soil and has the capacity to grow on up to 17% NaCl [39].

The R. vietnamensis, which has been synonymized with B. vietnamensis, is a mesophilic aerobic species isolated from Vietnamese fish sauces that is capable of forming spores [40, 41]. Identified as B. haikouensis, 12M1F and 3M2G strains had close relationships with R. vietnamensis, sharing more than 99.8% of 16S rRNA gene sequences. This finding might indicate possible similarities in the characteristics of Malaysian and Vietnamese fish sauces. Bacillus has been addressed as one of most prevalent and beneficial microbes in fermented fish mostly due to its unique contribution during the fermentation process [42]. Bacillus strains isolated from fish sauces had amino oxidase activity, which could decrease biogenic amine accumulation during fish-sauce fermentation; thus, improving safety of the final products.

Moreover, certain Bacillus strains derived from fermented foods have demonstrated probiotic activities in in vitro and in vivo experiments, which further expands their benefits in addition to their abilities to produce a variety of enzymes. Production of proteases, lipases, lipopeptides and extracellular polymers by probiotic Bacillus spp. enhances taste, nutritional value and safety of fermented foods [43]. Finding of this study have contributed to the body of knowledge in term of Bacillus strains possessing the ability to produce various enzymes. These strains can be used in the food industry, particularly for applications requiring enzymes and microorganisms that can persist extreme salinity. They may effectively be integrated with traditional fish fermentation practices to accelerate fermentation and enhance the flavor profile of fish sauces.

  1. Conclusion

In this study, six Bacillus strains isolated from Malaysian fish sauces were isolated, demonstrating hydrolytic and glutamic acid-accumulating capacities. Proteases were generally higher at 30 °C and 25% NaCl and in the middle of the stationary phase with B. licheniformis 12N3A had the highest protease activity. In contrast, lipase activity was maximum at 35 °C and 30% NaCl and the onset of the stationary phase with B. haikouensis 12M1F. Bacillus sp. 3M3A and Bacillus sp. 6M2A demonstrated the highest esterase and glutamic-acid accumulating activities, respec-tively. Stability and resistance to NaCl of halotolerant strains and their enzymes are essential in a variety of scientific, industrial and environmental applications. Furthermore, hydrolases produced by strains from various ecological environments may have unique characteristics and abilities, which can expand the range of enzymes available for uses in specific areas.

  1. Acknowledgements

This study was supported by the Universiti Putra Malaysia IPS grant no. GP-IPS/2023/9747400 and the Southeast Asian Regional Center for Graduate Study and Research in Agriculture (SEARCA) PhD scholarship grant no. GBG20-3243.

  1. Conflict of Interest

The authors declare no conflict of interest.

  1. Authors Contributions

Conceptualization, S.D.L; methodology, S.D.L., N.H.; software, S.D.L.; validation, N.H.; formal analysis, S.D.L.; investigation, S.D.L.; resources, N.H., A.S.M.H., S.M. and Y.S.S.; data curation, N.H.; writing—original draft preparation, S.D.L; writing-review and editing, S.D.L., N.H., A.S.M.H. &Y.S.S.; visualization, S.D.L.; supervision, N.H., A.S.M.H., S.M. and Y.S.S.; project administration, S.D.L., N.H.; funding acquisition, S.D.L. and N.H.

  1. Using Artificial Intelligent Chatbots

Artificial Intelligent chatbots have not been used in any section of the manuscript.

References

  1. Lestari SD, Hussin ASM, Mustafa S, Sew YS, Gan HM, Mohd Hashim A. Bacterial community structure, predicted metabolic activities and formation of volatile compounds attributed to Malaysian fish sauce flavor. Food Chem. 2023; 426: 136568.

https://doi.org/10.1016/j.foodchem.2023.136568

  1. Wang Y, Li C, Zhao Y, Li L, Yang X, Wu Y, Chen S, Cen J, Yang S, Yang D. Novel insight into the formation mechanism of volatile flavor in Chinese fish sauce (yu-lu) based on molecular sensory and metagenomics analyses. Food Chem. 2020; 323: 126839.

https://doi.org/10.1016/j.foodchem.2020.126839

  1. Kianirad S, Shakiba D, Hatamian-Zarmi A, Mokhtari-Hosseini ZB, Alvandi H, Ansari E, Hosseinzadeh, BE. Ganoderic acid production via aerial co-cultivation of Ganoderma lucidum with Bacillus subtilis and Aspergillus niger using bubble column bioreactor. Appl Food Biotechnol. 2024; 11(1): 1–12.

https://doi.org/10.22037/afb.v11i1.43684

  1. Zang J, Yu D, Li T, Xu Y, Regenstein JM, Xia W. Identification of characteristic flavor and microorganisms related to flavor formation in fermented common carp (Cyprinus carpio L.). Food Res Int. 2022; 155: 111128.

https://doi.org/10.1016/j.foodres.2022.111128

  1. Zinjanab MS, Golmakani MT, Eskandari MH, Toh M, Liu SQ. Yeast-Lactobacillus co-cultures as in situ ethanol producers for flavor ester synthesis using lipase in fermented milks. Appl Food Biotechnol. 2021; 8(2): 151-159.

https://doi.org/10.22037/AFB.V8I2.30873

  1. Wang Y, Wu Y, Li C, Zhao Y, Xiang H, Li L, Yang X, Chen S, Sun L, Qi B. Genome-resolved metaproteomic analysis of microbiota and metabolic pathways involved in taste formation during Chinese traditional fish sauce (yu-lu) fermentation. Front Nutr. 2022; 9: 1-13.

https://doi.org/10.3389/fnut.2022.851895

  1. Li Y, Li W, Li C, Li L, Yang D, Wang Y, Chen S, Wang D, Wu Y. Novel insight into flavor and quality formation in naturally fermented low-salt fish sauce based on microbial metabolism. Food Res Int. 2023; 166: 112586.

https://doi.org/10.1016/j.foodres.2023.112586

  1. Zheng B, Liu Y, He X, Hu S, Li S, Chen M, Jiang W. Quality improvement on half-fin anchovy (Setipinna taty) fish sauce by Psychrobacter sp. SP-1 fermentation. J Sci Food Agric. 2017; 97(13): 4484–4493.

https://doi.org/10.1002/jsfa.8313

  1. Kumaunang M, Sanchart C, Suyotha W, Maneerat S. Virgibacillus halodenitrificans MSK-10P, a potential protease-producing starter culture for fermented shrimp paste (kapi) production. J Aquat Food Prod Technol. 2019; 28(8): 877–890.

https://doi.org/10.1080/10498850.2019.1652874

  1. Do Quynh Nguyen A, Sekar A, Kim M, Phat Nguyen L, Thi Le N, Uh S, Hong S, Kim K. Fish sauce fermentation using Marinococcus halotolerans SPQ isolate as a starter culture. Food Sci Nutr. 2021; 9(2): 651-661.

https://doi.org/10.1002/fsn3.2024

  1. Udomsil N, Rodtong S, Tanasupawat S, Yongsawatdigul J. Proteinase-producing halophilic lactic acid bacteria isolated from fish sauce fermentation and their ability to produce volatile compounds. Int J Food Microbiol. 2010; 141(3): 186-194.

https://doi.org/10.1016/j.ijfoodmicro.2010.05.016

  1. Ohshima T, Giri A. Fermented foods: traditional fish fermen-tation technology and recent developments. In: Encyclopedia of Food Microbiology: Second Edition. Elsevier Inc.; 2014. p. 852-869.

https://doi.org/10.1016/B978-0-12-384730-0.00117-8

  1. Kanjan P, Sakpetch P. Functional and safety assessment of Staphylococcus simulans PMRS35 with high lipase activity isolated from high salt-fermented fish (budu) for starter development. LWT - Food Sci Technol. 2020; 124: 109183.

https://doi.org/10.1016/j.lwt.2020.109183

  1. Namwong S, Tanasupawat S. Characterization of lipase-producing Haloarcula strain from Thai fish sauce. Chiang Mai J Sci. 2017; 44(1): 39-49.

https://it.science.cmu.ac.th/ejournal/dl.php?journal_id=7657

  1. Ai L, Huang Y, Wang C. Purification and characterization of halophilic lipase of Chromohalobacter sp. from ancient salt well. J Basic Microbiol. 2018; 58(8): 647–657.

https://doi.org/10.1002/jobm.201800116

  1. Ramnath L, Sithole B, Govinden R. Identification of lipolytic enzymes isolated from bacteria indigenous to Eucalyptus wood species for application in the pulping industry. Biotechnol Reports. 2017; 15:114-124.

https://doi.org/10.1016/j.btre.2017.07.004

  1. Cupp-Enyard C, Aldrich S. Sigma’s non-specific protease activity assay - Casein as a substrate. J Vis Exp. 2008; (19).
  2. Guan C, Tao Z, Wang L, Zhao R, Chen X, Huang X, Su J, Lu Z, Chen X, Gu R. Isolation of novel Lactobacillus with lipolytic activity from the vinasse and their preliminary potential using as probiotics. AMB Express. 2020; 10(1).

https://doi.org/10.1186/s13568-020-01026-2

  1. Bhatnagar T, Boutaiba S, Hacene H, Cayol J-L, Fardeau M-L, Ollivier B, Bhatnagar T, Boutaiba S, Hacene H, Cayol J-L, Fardeau M-L,Ollivier B, Baratti JC. Lipolytic activity from Halobacteria: screening and hydrolase production. FEMS Microbiol Lett. 2005; 248(2): 133-140.

https://doi.org/10.1016/j.femsle.2005.05.044

  1. Jaeger KE, Kovacic F. Determination of lipolytic enzyme activities. Methods Mol Biol. 2014; 1149: 111-134.

https://doi.org/10.1007/978-1-4939-0473-0_12

  1. Shyamkumar R, Ganesh Moorthy IM, Ponmurugan K, Baskar R. Production of L-glutamic acid with Corynebacterium glutamicum (NCIM 2168) and Pseudomonas reptilivora (NCIM 2598): A study on immobilization and reusability. Avicenna J Med Biotechnol. 2014; 6(3): 163-168.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4147103

  1. Ayrapetyan M, Oliver JD. The viable but non-culturable state and its relevance in food safety. Curr Opin Food Sci. 2016; 8: 127-133.

https://doi.org/10.1016/j.cofs.2016.04.010

  1. Wakinaka T, Iwata S, Takeishi Y, Watanabe J, Mogi Y, Tsukioka Y, et al. Isolation of halophilic lactic acid bacteria possessing aspartate decarboxylase and application to fish sauce fermentation starter. Int J Food Microbiol. 2019; 292:137-143.

https://doi.org/10.1016/j.ijfoodmicro.2018.12.013

  1. Sorapukdee S, Sumpavapol P, Benjakul S, Tangwatcharin P. Collagenolytic proteases from Bacillus subtilis B13 and B. siamensis S6 and their specificity toward collagen with low hydrolysis of myofibrils. LWT - Food Sci Technol. 2020; 126: 109307.

https://doi.org/10.1016/j.lwt.2020.109307

  1. Contesini FJ, Melo RR de, Sato HH. An overview of Bacillus proteases: from production to application. Crit Rev Biotechnol. 2018; 38(3): 321-334.

https://doi.org/10.1080/07388551.2017.1354354

  1. Nguyen T, Nguyen CH. Determination of factors affecting the protease content generated in fermented soybean by Bacillus subtilis 1423. Energy Reports. 2020; 6:831-836.

https://doi.org/10.1016/j.egyr.2019.11.011

  1. Jung JY, Lee HJ, Chun BH, Jeon CO. Effects of temperature on bacterial communities and metabolites during fermentation of myeolchi-aekjeot, a traditional Korean fermented anchovy sauce. PLoS One. 2016; 11(3):1-21.

https://doi.org/10.1371/journal.pone.0151351

  1. Sinsuwan S, Rotdong S, Yongsawatdigul J. NaCl‐activated extracellular proteinase from Virgibacillus sp SK37 isolated from fish sauce fermentation. J Food Sci. 2007; 72(5):264-269.

https://doi.org/10.1111/j.1750-3841.2007.00375.x

  1. Arber W. Genetic variation: Molecular mechanisms and impact on microbial evolution. FEMS Microbiol Rev. 2000; 24(1): 1-7.

https://doi.org/10.1111/j.1574-6976.2000.tb00529.x

  1. Kumar R, Mahajan S, Kumar A, Singh D. Identification of variables and value optimization for optimum lipase production by Bacillus pumilus RK31 using statistical methodology. N Biotechnol. 2011; 28(1): 65–71.

https://doi.org/10.1016/j.nbt.2010.06.007

  1. Nguyet PT, Thanh NH, Hai TN, Janson J-C. Studies on a novel recombinant lipase A from Bacillus subtilis FS2. ASEAN J Sci Technol Dev. 2017; 25(2): 333-340.

https://doi.org/10.29037/ajstd.263

  1. Xin L, Hui-Ying Y. Purification and characterization of an extracellular esterase with organic solvent tolerance from a halotolerant isolate, Salimicrobium sp. LY19. BMC Biotech-nol. 2013; 13.

https://doi.org/10.1186/1472-6750-13-108

  1. Bhardwaj KK, Mehta A, Thakur L, Gupta R. Influence of culture conditions on the production of extracellular esterase from Bacillus licheniformis and its characterization. J Oleo Sci. 2020; 69(5):467-477.

https://doi.org/10.5650/jos.ess19261

  1. Ribera J, Estupiñán M, Fuentes A, Fillat A, Martínez J, Diaz P. Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past. PLoS One. 2017; 12(7):1-24.

https://doi.org/10.1371/journal.pone.0181029

  1. Rohban R, Amoozegar MA, Ventosa A. Screening and isolation of halophilic bacteria producing extracellular hydrolyses from Howz Soltan Lake, Iran. J Ind Microbiol Biotechnol. 2009; 36(3): 333-340.

https://doi.org/10.1007/s10295-008-0500-0

  1. Zareian M, Ebrahimpour A, Bakar FA, Mohamed AKS, Forghani B, Ab-Kadir MSB, Saari N. A glutamic acid-producing lactic acid bacteria isolated from Malaysian fermented foods. Int J Mol Sci. 2012; 13(5): 5482–5497.

https://doi.org/10.3390/ijms13055482

  1. Feng J, Quan Y, Gu Y, Liu F, Huang X, Shen H, Dang Y, Cao M, Gao W, Lu X, Wang Y, Song C, Wag S. Enhancing poly-γ-glutamic acid production in Bacillus amyloliquefaciens by introducing the glutamate synthesis features from Corynebacterium glutamicum. Microb Cell Fact. 2017; 16(1):1-12.

https://doi.org/10.1186/s12934-017-0704-y

  1. Liu Q, Cheng H, Ma X, Xu N, Liu J, Ma Y. Expression, characterization and mutagenesis of a novel glutamate decar-boxylase from Bacillus megaterium. Biotechnol Lett. 2016; 38(7):1107-1113.

https://doi.org/10.1007/s10529-016-2070-y

  1. Li J, Yang G, Lu Q, Zhao Y, Zhou S. Bacillus haikouensis sp. nov., a facultatively anaerobic halotolerant bacterium isolated from a paddy soil. Antonie Van Leeuwenhoek. 2014; 106(4): 789–794.

https://doi.org/10.1007/s10482-014-0248-7

  1. Gupta RS, Patel S, Saini N, Chen S. Robust demarcation of 17 distinct Bacillus species clades, proposed as novel Bacillaceae genera, by phylogenomics and comparative genomic analyses: Description of Robertmurraya kyonggiensis sp. nov. and proposal for an emended genus Bacillus limiting it only to the members of the Subtilis and Cereus clades of species. Int J Syst Evol Microbiol. 2020; 70(11): 5753-5798.

https://doi.org/10.1099/ijsem.0.004475

  1. Noguchi H, Uchino M, Shida O, Takano K, Nakamura LK, Komagata K. Bacillus vietnamensis sp. nov., a moderately halotolerant, aerobic, endospore-forming bacterium isolated from Vietnamese fish sauce. Int J Syst Evol Microbiol. 2004; 54(6): 2117-2120.

https://doi.org/10.1099/ijs.0.02895-0

  1. Narzary Y, Das S, Goyal AK, Lam SS, Sarma H, Sharma D. Fermented fish products in South and Southeast Asian cuisine: Indigenous technology processes, nutrient composition and cultural significance. J Ethn Foods. 2021; 8(1).

https://doi.org/10.1186/s42779-021-00109-0

  1. Liu S, Zhao L, Li M, Zhu Y, Liang D, Ma Y, Sun LX, Zhao G, Tu Q. Probiotic Bacillus as fermentation agents: Status, potential insights and future perspectives. Food Chem X. 2024; 22: 101465.

https://doi.org/10.1016/j.fochx.2024.101465

 

 



 

Background and Objective: Presence of heat-resistant mold ascospores in fruit juices includes a significant concern for the food industry. Pulsed electric field and power ultrasound technology, as an innovative non-thermal food preservation technology, were used for the decrease of Paecilomyces variotii spores in orange juice.

Material and Methods: In the current study, pulsed electric-field method (65 kV cm-1) was compared to ultrasound (< 5W ml-1) and thermosonication (combined ultrasound and heat, < 5W ml-1 -75 °C) methods for the inactivation of Paecilomyces variotii spores in orange juice. The major objectives were to investigate log reductions of Paecilomyces variotii spores and effects of juice soluble-solid contents under pulsed electric-field treatments and to compare pulsed electric-field followed by thermal processing and conventional thermal processing alone. Standard deviations and statistical analyses of the results were reported to highlight differences between the treatments. In addition, the log survival curves after pulsed electric field were modelled and the spore morphology was investigated.

Results and Conclusion: For a 30-min process (corresponding to a 288-s effective time), pulsed electric field was more effective in decreasing Paecilomyces variotii spores than that ultrasound and thermosonication were, showing three and up to one logs, respectively. The soluble solid content of orange juices affected the spore decreases after pulsed electric field, lesser in higher soluble solids (more than four logs in 10° Brix and equal or less than two logs in 30° Brix juices). The Weibull model could well demonstrate the log survival curves after pulsed electric-field treatments. Pulsed electric field followed by thermal process (144 s at 52, 72 and 92 °C for 10 min) was the best method, compared to that pulsed electric field or thermal processing alone was, providing more than two-log reductions in Paecilomyces variotii spores. Scanning electron microscopy showed a severe damage to Paecilomyces variotii spores after using a combination of pulsed electric field and heat process. In general, pulsed electric field assisted thermal technology, included better prevention of juice spoilage and enhanced safety of orange juices that were contaminated with Paecilomyces variotii spores.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Spoilage microorganisms in pasteurized fruit juices, pulps and concentrates pose a major economic risk and hence a great concern for the fruit juice processors globally. Most listed spoilage and high-level heat resistance bacteria in these beverages include Alicyclobacillus acidoterrestris [1]. Molds such as Byssochlamys nivea, B. fulva, Neosartorya fischeri, Talaromyces spp. and Eupenicillium spp. are involved in quality and safety of these foods due to their production of mycotoxins [2]. Paecilomyces species is another heat-resistant mold that can survive heat treatments due to its ability to produce ascospores [3]. According to Dijksterhuis et al. [4], B. nivea (also known as P. niveus) and B. spectabilis (also known as P. variotii) have frequently been associated with fruit juice spoilage [4]. The P. variotii and P. lilacinus are two prevalent molds that contribute to food and beverage spoilages. Moreover, P. variotii has shown a capability to grow at low oxygen concentrations under refrigeration conditions in pasteurized fruit juices, canned fruits and non-carbonized sodas [2, 5]. Thus, little attentions have been dedicated to Paecilomyces spp. and their inactivation in foods and beverages. Isolation of Paecilomyces spp. in fruits, cereals, grains, meat products, nuts, oils, margarines, processed cheeses [5], Moroccan olives, olive cakes [6], couscous, rice [7], sauces, juices [8], seeds [9] and roasted coffees [10] has been reported. In addition, degradation in food preservatives such as sorbic, benzoic and propionic acids with shifts in the aroma of food offerings has been observed [4].

Several investigators have reported heat resistance indices of P. variotii spores. Pieckova and Samson [7] showed that the ascospores of P. variotii survived 100 ºC for 0.5–1.5 min in juices, whereas Houbraken et al. [11] reported survive of this mold spores after 1 h of treatment at 85 ºC. The D-value of 3.4 min for P. variotii in distilled water (DW) after thermal treatment at 85 °C and D-value of 3.5 s for P. variotii in deionized water after a combination of hydrogen peroxide (40%) (H2O2) and heat (60 °C) were registered [12]. Evelyn et al. [2023] reported Weibull model with tailings (indicating high resistance) for the inactivation of P. variotii ascospores using a combination of ultrasound and heat (75 °C) [13]. The thermotolerant nature of this species is associated with its pathogenicity such as hyalohyphomycosis, showing a variety of human infections and hence potential dangers such as cutaneous, endocarditis, endophthalmitis, peritonitis, pneumonia, osteomyelitis, pyelonephritis and sinusitis [3]. Although the relationship of pathogenicity to contaminated foods is still unclear.

Thermal processing is the most common technology used in industrial food production by decreasing harmful microorganisms. However, heating can affect nutritional characteristics and sensory appearance of the processed foods [14]. Pulsed electric field (PEF) technology is one of the creative, contemporary, non-thermal approaches for food preservation that is interested worldwide. Other technologies include high-pressure processing, ultrasound, supercritical carbon dioxide (CO2) and irradiation, which can avoid significant deterioration to the food characteristics and extend the food shelf life [15, 16]. Less adverse effects of the technologies are due to their uses without or with little direct heats on the food materials, whereas the achievement of the shelf-life extension is due to the inactivation of commonly 5 or 6 logs of the pathogenic or spoilage microorganisms. Food preservation through PEF consists of using electric forces of generally 10–80 kV cm-1 to the food materials for a few micro to milliseconds [17]. Variables such as the intensity of the electric field, pulse width and configuration, number of pulses and temperature of the PEF treatment with the product nature (pH, water activity and electrical conductivity) and the characteristics of microbes (type of microorganisms, species and varieties) determine how much microbial inactivation is achieved. The PEF technology seems an appropriate pasteurization technique for liquid edibles such as fruit juices and dairy products [18]. Recent literatures have demonstrated its potentials for extending the shelf life of milks while maintaining their quality attributes [19, 20]. Other studies have shown that the PEF technology can preserve bioactive characteristics of the black-chokeberry juices [21].

Numerous researchers have assessed inactivation of disease-causing and deteriorating fungal spores (conidiospores and ascospores) using PEF; however, none was reported with the spoilage and pathogenic of significant importance of P. variotii and its associated ascospores. Reported fungal spores were B. nivea [22], B. fulva [23], N. fischeri [23], Zygosaccharomyces bailii [24], Penicillium expansum [25], E. javanicum [26], Botrytis cinerea [27] and Saccharomyces cerevisiae [28, 29], all in fruit juices and concentrates as well as beers. The simple (first-order and Weibull) kinetic models were only reported for Z. bailii spores [24] as well as the current authors’ previous studies with E. javanicum spores [26]. The magnitude of inactive-ation is mostly affected by factors such as type of spores, electric field intensity, treatment time, suspending media and total soluble solids in juice. The mechanism of spore inactivation or decrease by PEF technology has been suggested for the bacterial spores, which is generally involves disruption of spore membranes, followed by inter-ference with essential cellular functions and DNA damages, ultimately leading to spore death [30].

Developing effective preservation techniques to lessen risks of heat-resistant molds in fruit juices includes significant importance. Regarding the lack of data regarding the efficacy of PEF in combating spoilage and pathogenic P. variotii, as well as the kinetic model and mechanism of fungal spore inactivation by PEF, objectives of this study were (i) to compare and model PEF and ultrasound inactivation of P. variotii spores in orange juices; (ii) to investigate and model PEF resistance of P. variotii spores in orange juices with various soluble solid contents; (iii) to compare log reductions of P. variotii spores after sequential PEF and heat treatments (PEF-assisted thermal), PEF or thermal process alone; and (iv) to investigate morphology of spores after PEF-assisted thermal or PEF process alone using electron microscopy.

  1. Materials and Methods

2.1. Microorganism

This study used P. variotii mold strain of InaCC F166 sourced from the Indonesian Culture Collection (InaCC). The fungal strain was grown on potato dextrose agar (Oxoid, UK) plates at 27 ºC for 3 d following the suppliers’ instructions. The P. variotii colonies showed a velvety and tan to olive-brown color on the agar surfaces, which was previously documented in the literature [31].

2.2. Ascospore production and enumeration

Ascospores of P. variotii were achieved after a 30-d cultivation at 27 ºC on PDA (Oxoid, UK) plates. Spores were collected from the agar surface by lightly scraping the mycelia floating in sterile DW using clean curved glass rods. Then, suspension was passed through sterilized glass wools to eliminate lingering fungal fragments. This suspension was originally prepared from the pellets acquired through spinning at 4,000× g and 4 °C for 15 min (DLAB Scientific, China) and three times of washing with sterile DW. Then, spore suspension was stored at 2 ºC until use [32, 33]. Presence of viable colonies of P. variotii in juices before and after processing was accomplished through the use of surface-plating onto PDA (Oxoid, UK). Before plating, appropriate decimal dilutions were carried out using sterile 0.1% (w/v) peptone water (Difco, USA) followed by incubation at 27 °C for 3–5 d until visible colonies were formed. Calculation of the average colony count was carried out from two plates with a range of 20–100 colonies [32, 33]. Number of the ascospores was reported as colony-forming units per milliliter (CFU ml-1) in the juice samples.

2.3. Orange juice preparation and inoculation

The PEF technology is seen as a promising technology for the pasteurization of orange juices [34] as well as possible contamination of P. variotii in this juices. Therefore, orange juice concentrates (pH 3.8 ±0.1) purchased from a local supermarket in aseptic containers were used as the suspending media for P. variotii spores. Depending on the designed experiments, concentrates were diluted to soluble solid concentrations of 30, 20 and 10º Brix. For PEF experiments, 10 ml of the spore suspension in 690 ml orange juice provided an almost 10 times more diluted inocula than that 0.3 ml of spore suspension in 2.7 ml of orange juice did in thermal treatments. A spore conc-entration of approximately ~106 CFU ml-1 before processing was used. For the two ultrasound treatments, 1.0 ml of P. variotii suspensions was added to 49 ml of orange juice to prepare an initial concentration of nearly 105 CFU ml-1.

2.4. Experimental design and statistical data analysis

In the first experiment, effectiveness of P. variotii spore decreases was investigated using PEF against ultrasound (US) and thermosonication (TS) (75 °C) processes for 30 min in 10° Brix orange juices. This treatment time correspo-nded to a maximum effective time of 288 s in PEF, achieved by multiplying a residence time of 30 min by the pulse width in the batch system [35]. The 30-min time was selected to show marked differences between the treatments. Three survival experiments were carried out for each treatment followed by calculating and plotting the P. variotii spore logarithmic reduction (log N/N0); where, No and N were the microbial count before and after processing, respectively. Results from the first experiment showed various inactivations between the PEF and ultrasonication. Therefore, in the second set of experiments, PEF treatments of orange juice were carried out at various soluble solid contents. At least two survival experiments and duplicate samples were used and the logarithmic number of survivors (log N/N0) against time was plotted for each soluble solid.  Survival curves in the first and the second experiments were used to model and estimate inactivation parameters. The model parameters corresponded to the means ±SD (standard deviation) of the results. In the other survival experiments, PEF-assisted thermal and thermal treatments of the orange juices were carried out at similar temperatures (three times) to compare results from the PEF treatments alone. Equipment and procedures used for PEF, including ultrasound and thermal treatments, were described in detail in other sections. Significant differences in the microbial log reductions or kinetic parameters in treatments/soluble solids were investigated by carrying out one-way analysis of variance (ANOVA) followed by the Tukey's test with a confidence level of 95% (p < 0.05) (Systat software v.13, Statsoft, USA). Random residuals, mean square error (MSE) and coefficient of determination (R2) were used to compare the performance of the various models. A relatively small MSE and R2 values close to 1 indicated adequacy of the model to describe the survival data [32, 33].

2.4.1 Pulsed electric field and pulsed electric field-assisted thermal processing

Domestically-produced and laboratory-sized PEF system with a layout format by previous studies was used to carry out a series of PEF assays [36]. System was equipped with a cooling system in the outlet. Setup consisted of a high-voltage pulse generator and a treatment enclosure containing 700 ml of the corresponding fruit juice. High-voltage square pulse generator produced an electric field intensity of up to 65 kV cm-1 (with electrodes 1 cm apart) with a width of 160 μs and frequency of 250 Hz, which was the maximum intensity for this equipment. Moreover, PEF with electric field intensities of 30–65 kV cm-1 was used to decrease fungal spores in fruit juices. Before each assessment, the PEF chamber was meticulously cleaned and sterilized with diluted Vircon solution (further washed with sterilized DW). This was repeated after the experiment was carried out. Juice samples at an inlet temperature of 25 °C with various Brix levels were exposed to PEF treatment for 288 s. An intense PEF treatment, such as high voltages and long times, might be necessary to ensure substantial microbial inactivation for food safety and stability [37]. Then, outcomes of spore decreases were analyzed to report the best model for explaining the inactivation, as discussed in another section. Regarding PEF-assisted thermal processing, PEF treatments were carried out for 144 s followed by heating at 52, 72 and 92 ºC for 10 min. This PEF time was selected because it showed satisfactory initial and constant decreases of spores. Further samples of the juice were used for microbial counting using a method previously described.

2.4.2 Ultrasound processing and thermosonication

The UCD-250 disrupter ultrasonic cell processor (20–25 Hz, 250 W; Biobase Biodustry, China) with a 3-mm sonotrode tip and an amplitude of 70% was used for all US and combinations of thermal experiments or TS assess-ments. This condition (the maximum energy allowed for the equipment) was selected due to high resistant of the fungal ascospores. Ultrasonication procedures for US and TS were generally followed based on the previous studies [32, 33]. Power density of the ultrasound equipment was 5 W ml-1; however, this value could be nearly 50% less than the actual value (< 5 W ml-1), as explained in previous reports [16]. In each process, a 50-ml sample of orange juice was transferred into an Erlenmeyer flask. Then, a sterilized sonotrode was immersed in the orange juice at a depth of approximately 1 cm from the bottom of the flask. Steriliz-ation was carried out using glutaraldehyde (2.4% v/v) followed by rinsing off the residues using sterile DW. Furthermore, US and TS processed samples were removed from the flask at specific intervals (5, 10, 20, 30 and 40 min) for enumeration. A temperature of 75 °C was used for the TS experiments (the maximum temperature for the equipment and similar temperatures for conditions in PEF and thermal processes), whereas US processes were carried out at room temperature (without heat). Then, samples were used to count the rest of spores, as explained in Section 2.2.

2.4.3 Thermal processing

Thermal resistance of P. variotii ascopores was assessed at 52, 72 and 92 ºC for 10 min to compare the results from PEF and ultrasound treatments, as well as comparing them to those of previous studies. First, thermostatic water bath was heated until the treatment temperature was achieved. Orange juices containing spore samples within plastic pouches were submerged into the preheated thermostatic water bath and incubated for various times. Treated samples were removed at various times and stored in ice water shower until the microbial count.

2.5. Kinetic modeling after pulsed electric-field and ultrasound treatments

Weibull equation expressed in decimal logarithmic form was used to investigate the log survivors of P. variotii ascospores once they were subjected to PEF, US and TS processes (Eq. 1). This model was commonly used to describe the log inactivation under non-thermal methods [15, 16].

                                                                                                                                                     Eq. 1

Two parameters from this model included b (the rate parameter that affected the speed; at which, the microorganism was inactivated) and n (the shape factor, which denoted a concavity with n > 1 or a tail with n < 1). Conventional first-order kinetic model was used to compare the Weibull models. DT-values in this model included time in minutes at a particular temperature necessary to cause a one-log reduction in the number of microbes from 10n to 10n−1 in the microbial concentration in foods. The logarithmic D-values could be present about the lethal temperature (or soluble solid content, DSS); where, inverse of the incline matched the zSS-value (ºBrix) (Eq. 2) [26, 37].

                                                                                                                                                              Eq. 2

Where, Dref was D-value at the reference soluble solid SSref and zSS was the decrease of soluble solids that decreased DSS by a factor of 10.

2.6. Scanning electron microscopy

In general, PEF (65 kV cm-1, 144 s) and PEF-assisted thermal (65 kV cm-1, 92ºC, for 10 min) treated ascospores in orange juices were selected and transferred to an external certified laboratory to assess effects of these treatments on the spore physical characteristics using scanning electron microscope (SEM). The two technologies demonstrated the best results for spore decreases within the other treatments. Spores were filtered from the liquids before drying using 0.45-μm filter papers and then delivered to the laboratory.

  1. Results and Discussion

3.1 Effects of pulsed electric field, ultrasound and thermosonication on Paecilomyces variotii spores

Figure 1 compares the 65 kV/cm PEF and < 5 W ml-1-20 kHz ultrasound (US and TS) processes of 10° Brix orange juices containing P. variotii spores for up to 45 min. Time in PEF represented the residence time during these treatments. Much higher log reductions were achieved with 65 kV cm-1-PEF than the US alone, indicating the benefit of PEF technology. For example, a spore decrease of 3.0 log was registered after 30 min of PEF treatment (corresponding to an effective treatment time of 288 s), while only a small effect on the spores was observed such as a 0.4-log reduction after 30 min of US process (p < 0.05). Increasing lethality of the ultrasound treatment using simultaneous ultrasound and thermal or TS at 75 °C only increased the reduction up to 1.0 log. Other studies compared PEF to the US and reported similar results such as 1.2-log reductions after 32.3 kV cm-1-340 µs-PEF against 4.3-log reductions after high-power ultrasound (1.5 W ml-1-24 kHz, 40 °C, 3 min) for Aspergillus niger spores in oil-water emulsions [36]. Comparing to this study, various results of spore decreases in the highlighted study (lower for PEF and higher for US) might be due to various factors such as various strengths of the PEF and US, fungal species, suspended media and microbial inactivation mechanisms of each treatment.

In previous studies, comparisons between the PEF, US and TS processes for the inactivation of microbial spores were limited. Regarding ultrasound, TS (24 kHz, 0.33 W ml-1) treatments for 40 min at 75 °C resulted in nearly 3.5 log for N. fischeri spores in apple juices while a 2.5 log was achieved for B. nivea spores in strawberry purees following spore activation after similar lethal treatments [32, 33]. Much higher log reductions (> 5 log) were seen for A. flavus spores in Sabouraud broth after 20 min of 20 kHz-120 µm-TS at 60 °C [39]. The S. cerevisiae yeast ascospores in 4.8% (alcohol/volume) beers exhibited 2.7 log reductions after 16.2 W ml-1-70 °C [395]. All these results verified effects of the highlighted factors. Comparison of log reductions under PEF treatments was explained in further details in other sections. 

Table 1 shows Weibull parameters achieved after fitting the survival curves of P. variotii spores post PEF and ultrasound uses. Weibull model is a straightforward simple model with two elements (b and n); in which, b stands for the spore inactivation rate and n signifies the variance from linearity [15, 16]. This has been used to model numerous thermal and non-thermal food processes. Although the PEF process showed a lower b-value (0.11 ±0.04) than that the TS process did at 75 °C (0.37 ±0.05) (p < 0.05), n-value of the PEF method was close to 1.0, indicating a close rate to linearity in contrast to survival curves with concave-upwards or tailings [15, 16]. These results verified the benefit of PEF technology.

Electric field strengths of 33–100 kV cm-1 and frequencies of 2–466 Hz, either alone or in combination with various temperatures (56–123 ºC), have been used to decrease fungal [23, 24, 26] and bacterial [41–44] spores with logarithmic reductions reported from 2.5 to 5.9 logs. Generally, PEF exposure resulted in less spore decreases in bacterial spores than in fungal spores. As previously explained, the mechanism of spore inactivation by PEF has been suggested based on the membrane rupture caused by high-voltage electric pulses that create permanent pores in the cell membranes (irreversible electroporation), leading to the loss of vital cellular contents and ultimately causing cell death [30].

3.2 Effects of the soluble solid contents on pulsed electric-field decreases of Paecilomyces variotii spores

Figure 2 illustrates the log survivors (fitted by the Weibull model) of P. variotii spores in 10, 20 and 30º Brix orange juices after 65 kV cm-1-PEF processes for up to 288 s. As can be seen from this figure, increased treatment time generally led to decreases in the spore at all soluble solid contents. The log reduction of P. variotii after 288 s-PEF treatments was 4.2 log when spores were suspended in 10° Brix juices. Sensitivity of the mold spores (ascospores and conidiospores) and conidia to PEF treatments leading to inactivation has been reported by several researchers. Spore-producer molds included B. fulva [23], Z. bailii [24], E. javanicum [26] and S. cerevisiae [28, 29]; although this behavior was less observed with N. fischeri [23]. In other studies, several researchers reported complete inhibition of germination-tube elongation of P. expansum and B. cinerea spores after increasing the electric field strength without reporting the logarithmic of spore decreases [25, 27].

In a previous study by the current authors, nearly 4.0 logs were achieved for E. javanicum ascospores in 10º Brix pineapple juices with similar conditions [26], indicating similarity in the resistance of the two mold spores to the PEF treatments. Other researchers achieved ≈4 log reduction of other mold spores in unadjusted orange juices using milder processing conditions such as 30 kV cm-1-2 pulses (corresponding to 4 µs, calculated from the number of pulses and pulse width) with Z. bailii ascospores in orange juices and 30 kV cm-1-11 pulses (corresponding to 24.2 µs, calculated from the number of pulses and pulse width) with B. fulva conidiospores in pineapple juices [23, 24], suggesting that the two fungal pathogens of P. variotii and E. javanicum might include higher resistances to PEF, compared to those Z. bailii and B. fulva spores.

 In a previous study [23], less than 1.0 log of N. fischeri ascospores was observed in fruit juices when subjected to 40 kV cm-1-40 pulses-PEF (corresponding to maximum 132 µs, calculated from the number of pulses and pulse width). Similarly, other authors reported a 1.2 log reduction of A. niger spores in oil-water emulsions after 32.3 kV cm-1-340 µs-PEF [36]. Milani et al. [28] achieved a 2.2 log reduction in S. cerevisiae ascospores in beers after an exposure of 46 kV cm-1-70 μs, while another study achieved 2.6-log decreases of S. cerevisiae ascospores in orange juices after 50 kV cm-1 accompanied by 50 ºC for 2.6 μs [29]. In conclusion, fungal spore inactivation by PEF depends on the species, food media, PEF intensity and temperature. The PEF with electric field strength equal or greater than 65 kV cm-1 or in combination with temperature greater than 50 ºC should be used to inactivate fungal ascospores to achieve recommended decreases in fruit juices (≈5 log).

The 288 s-PEF treatments resulted in 4.2, 2.7 and 2.0 log reductions in the P. variotii ascospores when the spores were suspended in 10, 20 and 30° Brix orange juices, respectively (p < 0.05). In previous research, the authors reported effects of soluble solids in the processing of pineapple juices containing E. javanicum ascospores (4.0 logs at 10º Brix, 3.1 logs at 20º Brix and 1.3 logs at 30º Brix) under similar conditions. Eshtiaghi and Nakthong [45] showed increased resistances of yeasts during PEF treatment when sugar concentration increased from 20 to 50% in apple juices. In addition to previous studies on E. javanicum spores by the current authors, this finding (protective effects of soluble solids on the PEF resistance of fungal spores) should add further data to the current literature. However, associated studies used thermal or non-thermal treatments and bacterial and mold spores in fruit juices as well as other non-liquid food items [46-48].

Weibull model compared to the first-order kinetic model was used to investigate effects of sucrose level on the inactivation rate. Based on the MSE and R2-values such as 0.043 ≤ MSE ≤ 0.218, 0.96 ≤ R2 ≤ 0.99, Weibull model provides better performance indices than those the linear model does. As seen in Table 2, differences in sucrose level by 20º Brix affected b-values such as 0.066–0.113 at 10-20º Brix against 0.019 at 30º Brix corresponding to Dss-value of 23.8 min ±0.97 (p < 0.05). A previous study with E. javanicum showed decreases in b-values from 0.673 at 30º Brix to 0.01 at 10º Brix juices. As previously stated, limited information were available on the kinetic inactivation of fungal spore after PEF treatments. Various investigations into the microbial cells and spore inactivation by PEF seem to manifest concavity trends in the survival curves or use a non-linear model such as Weibull to explain their inactivation [23, 49, 50]. The n-values describe nonlinearity or concavity of the survival curves.

From Table 2, these values vary from 0.95 ±0.17 to 1.23 ±0.04, showing ascending (n less than 1) and descending (n greater than 1) tendencies of the PEF survival curves (Fig. 2). Generally, an upward-curving type demonstrates a combination of the resistances of spore populations to lethal treatments such as kills, whereas a downward-curving type reveals spore resistance to the sublethal treatment such as a number of survivors being physiologically injured [51]. Fruit juices available in the market usually include 10 and 30º Brix; thus, a 65 kV cm-1 PEF treatment for 288 s could decrease 2.0 and 4.2 logs of P. variotii ascospores in 30 and 10º Brix juices, respectively.

3.3 Pulsed electric-field assisted thermal processing of Paecilomyces variotii spores in orange juices

Comparison of PEF-assisted thermal, PEF and heat alone on P. variotii spore survivors were investigated (Fig. 3). Thermal processes were carried out at 52, 72 and 92 ºC. Results included proofs of disparities in the log reductions achieved after these processes with PEF and 92 ºC and generally showed the highest difference to the PEF or heat alone. For the spores suspended in 10º Brix juices, treatments resulted in 1.42 logs for PEF against 3.28 logs for PEF and 52 ºC, 3.74 logs for PEF and 72 ºC and 4.13 logs for PEF and 92 ºC (p < 0.05). Although log reductions were lower for 30º Brix juices due to the protective effects of sugar content, differences in the log reductions between PEF and PEF-thermal were observed (0.48 log for PEF against 1.34 logs for PEF and 52 ºC, 1.70 logs for PEF and 72 ºC and 2.0 logs for PEF and 92 ºC (p < 0.05). Thermal processing of spores suspended in 10º Brix juices produced 0.72, 1.0 and 1.52 logs at 52, 72 and 92 ºC, respectively (p < 0.05). In addition, heating the 30º Brix juice inoculated with the spores provided 0.29–0.37 log at 52–72 ºC against 0.57 log at 92 ºC (p < 0.05). Therefore, results showed that the PEF-assisted thermal treatments provided up to 1.3 logs more inactivation in the orange juices, compared to when the individual methods (PEF and thermal) were used in combination, indicating synergistic effects. The PEF-assisted thermal process showed more spore decreases (up to 2.74 logs) than those the thermal process alone did, suggesting that the PEF-assisted thermal process was the best method for spore inactivation, compared to PEF or thermal process alone. To the best of the authors’ knowledge, no studies have reported the PEF-assisted thermal treatments of fungal spores. However, other investigators revealed that 50 kV cm-1-PEF treatments with an outlet temperature of 50 ºC for 2.6 μs resulted in 2.5-log decreases in the ascospores of S. cerevisiae in orange juices [29]. This was lower than the log reduction achieved after 50 kV cm-1-PEF at 52 ºC in the present study (3.28 logs). No other information are available on the PEF assisted thermal treatments on fungal spores. However, these results were similar to those by previous studies with bacterial spores [52], showing additional inactivation of up to 3.3 logs for Geobacillus stearothermophilus spores in skim milks and Bacillus subtilis in Ringer’s solutions after PEF-assisted thermal treatments.

In conclusion, results have suggested that PEF treatment can sensitize fungal spores to heat treatments; although the exact mechanism with fungal spores is still unclear and needs further investigations. Based on previous hypotheses by the current authors on bacterial spores [52], increased inactivation due to PEF-thermal was likely caused by the displacement of ions from the internal spore membrane and their migration through the inner core of the spores, decreasing protective barrier function of the inner mem-rane and hence making spores further susceptible to further processing (heat). Further studies are needed to describe exact mechanism of the PEF inactivation of heat-resistant fungal spores. Nonetheless, SEM studies of the spores after this process and PEF alone were further carried out.

3.4 Morphological observation of Paecilomyces variotii spores after pulsed electric field and pulsed electric field-assisted thermal treatments

Naturally, P. variotii produces heat-resistant ascospores and hence spore characteristics resemble Byssochlamys (Byssochlamys-morph) spores or others in the Subkingdom Ascomycetes, including Neosartorya and Talaromyces spp. Orange juice-suspended spores of P. variotii, which were treated by PEF-thermal and PEF alone, were analyzed by SEM (Fig. 4). According to Rozali et al. [53], morphology of the live untreated N. fischeri spores presents precisely-defined sharp edges in the external surface of the mold spores with breaks between the pointed edges and cubic forms. The two images in the figure (especially shown by yellow and red arrows) provide well-visible evidence of cellular destruction around the spores, including significant changes in the spore appearance such as thinning and release of intracellular spore components following the lethal processes. However, lesser destructions and denser populations were seen for the spores treated by the PEF alone (65 kV cm-1-144 s, Fig. 4A), compared to the spores treated by PEF-thermal method (65 kV cm-1-144 s and 92 ⁰C-10 min, Fig. 4B). These results indicated that degrees of the cell membrane damages and electroporation were higher after the PEF-assisted thermal treatments [54]. Not much information are available on the SEM inspections of heat-resistant mold ascospores after thermal and non-thermal processing such as PEF, particularly for P. variotii. Using SEM images, Evrendilek et al. observed the morphological alterations such as cytoplasmic coagulation, vacuolation, shrinkage and protoplast leakage of B. cinerea spores and P. expansum conidia after 17–30 kV cm-1-163 µs PEF treatments, which completely inhibited spore germination and germination-tube elongation [25, 27]. In another study with S. cerevisiae, morphology study by SEM showed that the surface of cells treated with PEF-assisted thermal process (25 kV cm-1, 50 °C) was rougher and more incomplete and porous than that of the cells treated by PEF alone [54]. Further extreme conditions were used in this study, which might damage microbial spores (e.g., spore bursts and release intracellular contents) after the lethal treatments.

  1. Conclusion

The 65 kV cm-1-PEF use for an effective time of 288 s was a better method for decreasing P. variotii spores than thermosonication of less than 5 W ml-1 at 75 °C. The PEF processing was able to respectively decrease 4.2, 2.7 and 2.0 logs of P. variotii ascospores in 10, 20 and 30º Brix orange juices, thus showing protective effects of the soluble solid contents for the inactivation. The log survival curves of these fungal spores after PEF were accurately described by the Weibull model with the achieved b and n values. However, the PEF-assisted thermal method (144 s PEF followed by 92 ⁰C-10 min thermal process) was the best method to process orange juices, compared to PEF or thermal process alone. Moreover, SEM studies verified these results. Therefore, the hurdle method such as sequential PEF and thermal treatment is a promising technique to achieve pasteurization by the manufacturers of orange juices contaminated by P. variotii ascospores. However, further studies are necessary to investigate the quality of juices after this process, suggesting that lower temperature may be needed for a better quality of the processed juices.

  1. Acknowledgements

This study was financially supported by The Directorate General of Higher Education, Culture, Research and Technology Republic Indonesia (grant no. 2361/UN19.5.1.3/PT.01.03/2022). The authors thank technicians (Suci Ramadhana and Indra Permana) for their assistance in the laboratory, Chemical Engineering Department, Faculty of Engineering, University of Riau.

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

“Conceptualization, E.E. and C.C.; methodology, E.E.; software, E.E. and C.C.; validation, C.C. and S.S.; formal analysis, E.E.; investigation, S.S. and Y.A.; resources, E.E.; data curation, C.C.; writing—original draft preparation, E.E.; writing—review and editing, C.C., S.S. and Y.A.; visualization, S.S.; supervision, C.; project administration, Y.A.; funding acquisition, E.E.”.

  1. Using Artificial Intelligent Chatbots

Artificial intelligent chatbots were not used in any section of this manuscript.

 

 

References

  1. Akhbariyoon HR, Mirbagheri M, Emtiazi G. Isolation and identification of Alicyclobacillus with high dipicolinic acid and heat resistant proteins from mango juice. Appl Food Biotechnol. 2016; 3(4): 270-274.

https://doi.org/10.22037/afb.v3i4.13429

  1. Rico-Munoz E, Samson RA, Houbraken J. Mould spoilage of foods and beverages: Using the right methodology. Food Microbiol. 2019; 81: 51-62.

https://doi.org/10.1016/j.fm.2018.03.016

  1. Moreira DC, Oliveira MME, Borba CM. Human pathogenic Paecilomyces from food. Microorganisms. 2018; 6(3): 64.

https://doi.org/10.3390/microorganisms6030064

  1. Dijksterhuis J, Houbraken J, Samson RA. Fungal Spoilage of Crops and Food, In: Kempken F. Agricultural Applications, 2nd Edition. Springer-Verlag, Berlin/Heidelberg, Germany. 2013: pp. 35-56.

https://doi.org/10.1007/978-3-642-36821-9_2

  1. Roussos S, Zaouia N, Salih G, Tantaoui-Elaraki A, Lamrani K, Cheheb M, Hassouni H, Verhe F, Perraud-Gaime I, Augur C, Ismaili-Alaoui M. Characterization of filamentous fungi isolated from Moroccan olive and olive cake: Toxinogenic potential of Aspergillus Mol Nutr Food Res. 2006; 50(6): 500-506.

https://doi.org/10.1002/mnfr.200600005

  1. Alkenz S, Sassi AA, Abugnah YS, Alryani MB. Isolation and identification of fungi associated with some Libyan foods. African J Food Sci. 2015; 9(7): 406-410.

https://doi.org/10.5897/AJFS2015.1318

  1. Pieckova E, Samson RA. Heat resistance of Paecilomyces variotii in sauce and juice. J Ind Microbiol Biotechnol. 2000; 24(1): 227-230.

https://doi.org/10.1038/sj.jim.2900794

  1. Pitt JI, Hocking DA. Fungi and Food Spoilage. Springer Nature, Zurich, Switzerland. 2022: 231-249.

https://doi.org/10.1007/978-3-030-85640-3

  1. Minamor AA, Odamtten GT. Influence of the culture filtrate of three Paecilomyces species on some growth parameters, chlorophyll content and root anatomy of two Ghanaian maize varieties (Abeleehi and Obaatanpa) and on germination capacity of tomato and pepper seeds. Am J Microbiol Res. 2017; 5: 51-58.

https://doi.org/10.12691/ajmr-5-3-1

  1. Casas-Junco PP, Ragazzo-Sanchez JA, Ascencio-Valle FJ, Calderon-Santoyo M. Determination of potentially mycotoxigenic fungi in coffee (Coffea arabica L.) from Nayarit. Food Sci Biotechnol. 2018; 27: 891-898.

https://doi.org/10.1007/s10068-017-0288-7

  1. Houbraken J, Samson RA, Frisvad JC. Byssochlamys: Significance of heat resistance and mycotoxin production. Adv Exp Med Biol. 2006; 571: 211-224.

https://doi.org/10.1007/0-387-28391-9_14

  1. Delgado DA, Sant’Ana AS, Granato D, de Massaguer PR. Inactivation of Neosartorya fischeri and Paecilomyces variotii on paperboard packaging material by hydrogen peroxide and heat. Food Control. 2012; 23: 165-170.

https://doi.org/10.1016/j.foodcont.2011.07.004

  1. Evelyn, Chairul, Ramadhani FH, Khiarunnisa R. The effects of ultrasound and ultrasound combined thermal treatment on the resistance of mold spores (Paecilomyces variotii) in orange juice. Mater Today: Proc. 2023; 87(2): 106-110.

https://doi.org/10.1016/j.matpr.2023.02.380

  1. Mendoza-Espinoza JA, Gomez-Covarrubias SI, Palacios ES, Alvarez-Ramirez E, Aarland RC, Rivera-Cabrera F, Gomez-Cansino R, Bustamante-Camilo P, de Leon-Sanchez FD. Effects of pasteurization on antihyperglycemic and chemical parameter of xoconostle (Stenocereus stellatus) juice. Appl Food Biotechnol. 2024; 11(1), e 4.

https://doi.org/10.22037/afb.v11i1.43252

  1. Evelyn, Silva FVM. Heat assisted HPP for the inactivation of bacteria, molds and yeasts spores in foods: Log reductions and mathematical models. Trends Food Sci Technol. 2019; 88: 143-156.

https://doi.org/10.1016/j.tifs.2019.03.016

  1. Evelyn, Silva FVM. Ultrasound-assisted thermal inactivation of spores in foods: Pathogenic and spoilage bacteria, molds and yeasts. Trends Food Sci Technol. 2020; 105: 402-415.

https://doi.org/10.1016/j.tifs.2020.09.020

  1. Nowosad K, Sujka M, Pankiewicz U, Kowalski R. The application of PEF technology in food processing and human nutrition. J Food Sci Technol. 2021; 58: 397-411.

https://doi.org/10.1007/s13197-020-04512-4

  1. Koubaa M, Barba FJ, Kovacevic DB, Putnik P, Santos MD, Queiros RP, Moreira SA, Inacio RS, Fidalgo LG, Saraiva JA. Pulsed Electric Field Processing of Fruit Juices. In: Rajauria G, Tiwari BK. Fruit Juices: Extraction, Composition, Quality and Analysis. Academic Press, Amsterdam, The Netherlands. 2018: pp. 437-449.

https://doi.org/10.1016/B978-0-12-802230-6.00022-9

  1. Kayalvizhi V, Sowmiya S, Priya TS, Antony U. Processing flavoured milk by thermal and non thermal methods. Asian J Dairy Food Res. 2021; 40(2): 129-135.

https://doi.org/10.18805/ajdfr.dr-1561

  1. Sujatha G, Sivakumar T, Pandian ASS, Chitrambigai K. Pulsed electric field technology - shelf life extension of milk. Indian J Dairy Sci. 2021; 74(2): 189-190.

https://doi.org/10.33785/ijds.2021.v74i02.013

  1. Oziembłowski M, Trenka M, Czaplicka M, Maksimowski D, Nawirska-Olszańska A. Selected properties of juices from black chokeberry (aronia melanocarpa l.) fruits preserved using the PEF method. Appl Sci. 2022; 12(14): 7008.

https://doi.org/10.3390/app12147008

  1. Grahl T, Markl H. Killing of microorganisms by pulsed electric fields. Appl Microbiol Biotechnol. 1996; 45(1-20): 148-157.

https://doi.org/10.1007/s002530050663

  1. Raso J, Calderon ML, Gongora M, Barbosa-Canovas GV, Swanson BG. Inactivation of mold ascospores and conidiospores suspended in fruit juices by pulsed electric fields. LWT - Food Sci Technol. 1998b; 31(7-8): 668-672.

https://doi.org/10.1006/fstl.1998.0426

  1. Raso J, Calderón ML, Gongora M, Barbosa-Canovas GV, Swanson BG. Inactivation of Zygosaccharomyces bailii in fruit juices by heat, high hydrostatic pressure and pulsed electric fields. J Food Sci. 1998a; 63(6): 1042-1044.

https://doi.org/10.1111/j.1365-2621.1998.tb15850.x

  1. Evrendilek GA, Tok FM, Soylu EM, Soylu S. Inactivation of Penicillum expansum in sour cherry juice, peach and apricot nectars by pulsed electric fields. Food Microbiol. 2008; 25(5): 662-667.

https://doi.org/10.1016/j.fm.2008.03.009

  1. Evelyn, Chairul, Komalasari, Pebrianti E, Vazirani W. Use of pulsed electric field for the inactivation of Eupenicillium javanicum ascospores in pineapple juice. J Phys Conf Ser. 2021; 2049: 012020.

https://doi.org/10.1088/1742-6596/2049/1/012020

  1. Evrendilek GA, Tok FM, Soylu EM, Soylu S. Effect of pulsed electric fields on germination tube elongation and spore germination of Botrytis cinerea inoculated into sour cherry juice, apricot and peach nectars. Italian J Food Sci. 2009; 21(2): 171-182.
  2. Milani EA, Alkhafaji S, Silva FVM. Pulsed electric field continuous pasteurization of different types of beers. Food Contr. 2016; 50: 223-229.

https://doi.org/10.1016/j.foodcont.2014.08.033

  1. McDonald CJ, Lloyd SW, Vitale MA, Petersson K, Innings F. Effects of pulsed electric fields on microorganisms in orange juice using electric field strengths of 30 and 50 kV/cm. J Food Sci. 2000; 65(6): 984-989.

https://doi.org/10.1111/j.1365-2621.2000.tb09404.x

  1. Wu WJ, Chang J. Inactivation of vegetative cells, germinated spores and dormant spores of bacillus atrophaeus by pulsed electric field with fixed energy input. J Food Proc Eng. 2022; 45(2): e13959.

https://doi.org/10.1111/jfpe.13959

  1. Nucci M, Anaissie EJ. Hyalohyphomycosis, In: Anaissie EJ, McGinnis MR, Pfaller MA. Clinical Mycology, 2nd Edition. Churchill Livingstone, London. 2009: pp. 309-327.

https://doi.org/10.1016/B978-1-4160-5680-5.X0001-1

  1. Evelyn E, Silva FVM. Inactivation of Byssochlamys nivea ascospores in strawberry puree by high pressure, power ultrasound and thermal processing. Intl J Food Microbiol. 2015; 214: 129-136.

https://doi.org/10.1016/j.ijfoodmicro.2015.07.031

  1. Evelyn E, Kim HJ, Silva FVM. Modeling the inactivation of Neosartorya fischeri ascospores in apple juice by high pressure, power ultrasound and thermal processing. Food Contr. 2016; 59: 530-537.

https://doi.org/10.1016/j.foodcont.2015.06.033

  1. Goshal G. Comprehensive review on pulsed electric field in food preservation: Gaps in current studies for potential future research. Heliyon. 9: e17532.

https://doi.org/10.1016/j.heliyon.2023.e17532

  1. Jin TZ. Pulsed Electric Fields for Pasteurization: Defining Processing Conditions, In: Miklavcic D. Handbook of Electroporation. Springer Cham, Switzerland. 2017: pp. 2271-2295.

https://doi.org/10.1007/978-3-319-26779-1_132-1

  1. Gomez-Gomez A, Brito-de la Fuente E, Gallegos C, Garcia-Perez JV, Benedito J. Combined pulsed electric field and high-power ultrasound treatments for microbial inactivation in oil-in-water emulsions. Food Contr. 2021; 130: 108348.

https://doi.org/10.1016/j.foodcont.2021.10834

  1. Jin TZ, Zhang HQ. Pulsed Electric Fields for Pasteurization: Food Safety and Shelf Life, In: Demirci A, Feng H, Krishnamurthy K. Food Safety Engineering. Springer Cham, Switzerland. 2020: pp. 553-577.

https://doi.org/10.1007/978-3-030-42660-6_21

  1. Evelyn, Utami SP, Chairul. Effect of temperature and soluble solid on Bacillus subtilis and Bacillus licheniformis spore inactivation and quality degradation of pineapple juice. Food Sci Technol Int. 2021; 28: 285-296.

https://doi.org/10.1177/10820132211019143

  1. Lopez-Malo A, Palou E, Jimenez-Fernández M, Alzamora SM, Guerrero S. Multifactorial fungal inactivation combining thermosonication and antimicrobials. J Food Eng. 2005; 67: 87-93.

https://doi.org/10.1016/j.jfoodeng.2004.05.072

  1. Milani EA, Silva FVM. Ultrasound assisted thermal pasteurization of beers with different alcohol levels: Inactivation of Saccharomyces cerevisiae J Food Eng. 2017; 198: 45-53.

https://doi.org/10.1016/j.jfoodeng.2016.11.015

  1. Bermudez-Aguirre D, Dunne P, Barbosa-Canovas GV. Effect of processing parameters on inactivation of Bacillus cereus spores in milk using pulsed electric fields. Intl Dairy J. 2012; 24(1): 13-21.

https://doi.org/10.1016/j.idairyj.2011.11.003

  1. Cregenzán-Alberti O, Arroyo C, Dorozko A, Whyte P, Lyng JG. Thermal characterization of Bacillus subtilis endospores and a comparative study of their resistance to high temperature pulsed electric fields (HTPEF) and thermal-only treatments. Food Contr. 2017; 73(Part B): 1490-1498.

https://doi.org/10.1016/j.foodcont.2016.11.012

  1. Siemer C, Toepfl S, Heinz V. Inactivation of Bacillus subtilis spores by pulsed electric fields (PEF) in combination with thermal energy-I. Influence of process-and product parameters. Food Contr. 2014; 39: 163-171.

https://doi.org/10.1016/j.foodcont.2013.10.025

  1. Soni A, Oey I, Silcock P, Ross IK, Bremer PJ. Effect of pulsed electric field with moderate heat (80°C) on inactivation, thermal resistance and differential gene expression in cereus spores. J Food Proc Preserv. 2020; 44: 14503.

https://doi.org/10.1111/jfpp.14503

  1. Eshtiaghi MN, Nakthong N. Application of pulsed electric field for inactivation of yeast cerevisiae in apple juice. J Phys Conf Ser. 2021; 1893: 012008.

https://doi.org/10.1088/1742-6596/1893/1/012008

  1. Evelyn, Muria, Chairul, Fozla D, Kusuma F. Thermal inactivation of Talaromyces flavus ascospores in pineapple juice as influenced by temperature, soluble solids and spore age. J Adv Res Fluid Mech Thermal Sci. 2020; 69(2): 111-119.

https://doi.org/10.37934/arfmts.69.2.111119

  1. Maldonado MC, Belfiore C, Navarro AR. Temperature, soluble solids and pH effect on Alicyclobacillus acidoterrestris viability in lemon juice concentrate. J Ind Microbiol Biotechnol. 2008; 35(2): 141-144.

https://doi.org/10.1007/s10295-007-0276-7

  1. Uchida R, Silva FVM. Alicyclobacillus acidoterrestris spore inactivation by high pressure combined with mild heat: Modeling the effects of temperature and soluble solids. Food Contr. 2017; 73(Part B): 426-432.

https://doi.org/10.1016/j.foodcont.2016.08.034

  1. Saldana G, Puertolas E, Alvarez I, Meneses N, Knorr D, Raso J. Evaluation of a static treatment chamber to investigate kinetics of microbial inactivation by pulsed electric fields at different temperatures at quasi-isothermal conditions. J Food Eng. 2010; 100(2): 349-356.

https://doi.org/10.1016/j.jfoodeng.2010.04.021

  1. Wouters PC, Dutreux N, Smelt JPPM, Lelieveld HLM. Effects of pulsed electric fields on inactivation kinetics of Listeria innocua. Appl Environ Microbiol. 1999; 65(12): 5364-5371.

https://doi.org/10.1128/AEM.65.12.5364-5371.1999

  1. Peleg M, Cole MB. Reinterpretation of microbial survival curves. Crit Rev Food Sci Nutr. 1998; 38(5): 353-380.

https://doi.org/10.1080/10408699891274246

  1. Reineke K, Schottroff F, Meneses N, Knorr D. Sterilization of liquid foods by pulsed electric fields-an innovative ultra-high temperature process. Front Microbiol. 2015; 6: 400.

https://doi.org/10.3389/fmicb.2015.00400

  1. Rozali SNM, Milani EA, Deed RC, Silva FVM. Bacteria, mold and yeast spore inactivation studies by scanning electron microscope observations. Intl J Food Microbiol. 2017; 263: 17-25.

https://doi.org/10.1016/j.ijfoodmicro.2017.10.008

  1. Yan Z, Yin L, Hao C, Liu K, Qiu J. Synergistic effect of pulsed electric fields and temperature on the inactivation of microorganisms. AMB Expr. 2021; 11(1): 47.

https://doi.org/10.1186/s13568-021-01206-8

Investigating Antibacterial Effects of Nano-Ag/titanium dioxide on Polylactic Acid Nanocomposites Produced Using Extrusion Method

Fatemeh Salimi, Hamed Ahari, Seyed Amir Ali Anvar , Abbasali Motallebi Moghanjoghi

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e28
https://doi.org/10.22037/afb.v11i1.45932

Background and Objective: Biodegradable polymers generally do not include antibacterial characteristics. This study investigated effects of various concentrations of nano-titanium dioxide containing silver on polylactic acid nanocomposites for their microscopic, chemical, roughness of the coatings and antibacterial characteristics against Staphylococcus aureus and Escherichia coli.

Material and Methods: Nanometric structure of the coatings was assessed through multiple steps. First, films containing 0.5, 1 and 3% wt% concentrations were produced using extrusion method and then analyzed and compared using scanning electron microscope and energy dispersive spectroscopy. Then, Fourier transform infrared spectroscopy and atomic force microscope were used to investigate functional groups, types of bonds, peak intensity variations and roughness characteristics of the films. Moreover, antimicrobial effects of the coatings was assessed on Staphylococcus aureus and Escherichia coli.

Results and Conclusion: Results of the scanning electron microscope indicated that the accumulation of nanoparticles in the films increased with increasing concentration of the nanoparticles. This increase affected energy dispersive spectroscopy, resulting in higher levels of titanium and silver nanoparticles. Fourier transform infrared spectroscopy revealed changes in intensity and position of the peaks due to the presence of nanoparticles. Bacterial growth assessments demonstrated that addition of nano-titanium dioxide containing silver to polylactic acid significantly decreased the growth of Staphylococcus aureus and Escherichia coli bacteria (p < 0.05). Based on the results, coatings containing 3 wt% of nano-titanium dioxide with silver showed the greatest decrease in bacterial growth.

Conflict of interest: The authors declare no conflict of interest.

Background and Objective: Incorporation of folic acid (vitamin B9) to breads is a solution to avoid folic acid deficiency. However, the vitamin stability is highly concerned, especially at high temperatures. Hence, encapsulation can be a useful protective strategy. In this study, stability of encapsulated folic acid was investigated in Saccharomyces cerevisiae after baking and during storage of Iranian breads (lavash and barbari)

.Material and Methods: Saccharomyces cerevisiae PTCC 5052 was treated via plasmolysis, autolysis and ultrasonication to compare protections of the vitamin. Loading capacity and encapsulation efficiency of the loaded cells were calculated. Thermal behaviors of the vitamin and yeast cells were studied using differential scanning calorimetry. Stability of free and encapsulated folic acid was assessed in the breads after baking and during storage (24 h for barbari and 24, 48 and 72 h for lavash) using high-performance liquid chromatography.

Results and Conclusion: Plasmolyzed, autolyzed and ultrasonicated yeast cells included encapsulation efficiency of 52.50, 56.38 and 47.11% and loading capacity of 18.80, 20.65 and 15.34%, respectively, more than those the intact cells did. Plasmolysis, autolysis and sonication did not lead to significant changes in morphology of the cells. Transmission electron microscopy images verified entrapment of the vitamin within the cells. Differential scanning calorimetry analysis showed endothermic dips at 60–70 °C for the intact and treated cells, which were linked to the protein degradation in the yeast cells. No significant peak/dip was observed in differential scanning calorimetry graphs of the intact and treated yeasts at higher temperatures, showing thermal stability. In the two types of breads, the autolyzed yeast cells showed the best vitamin protection after baking and during storage. Encapsulation of folic acid in Saccharomyces cerevisiae is a practical approach in stability of folic acid in foods at high temperatures.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

During the last two decades, interests in healthy living and eating have increased [1]. Introducing novel food formulations with health benefits can increase health of the consumers [2]. Folic acid or vitamin B9 is commonly used in fortified foods, especially flours and rice [3]. Production of food supplements and/or fortified foods is a favorable strategy to achieve sufficient folic acid within a day [3,4]. Encapsulated compounds effectively can improve their stability and bioavailability in foods [5]. The wide range of folic acid derivatives, their high sensitivity to light, heat and oxidation make folic acid analysis in foodstuffs quite difficult [6]. Low stability of folic acid is a big challenge for food scientists and nutritionists because inherent degradability of folic acid decreases its bioactivity [2,7–8]. To provide bioactive compounds with a high chemical stability, their encapsulation within protective and stable shells has been interested in recent decades [9]. Yeast cells have successfully been used for encapsulation of bioactive components [10]. These cells can stabilize susceptible bioactive components under harsh conditions. Of yeasts, Saccharomyces cerevisiae (baker's and brewer's yeast) has emerged as a promising host for developing novel types of drug delivery systems [11,12,10]. It provides a lipid bilayer with a network of mannoproteins and fibrous β-1,3-glucans [11,12,10]. The β-glucans and mannooligosaccharides are the major structural sugars of the yeast cell wall [11]. This specific structure can protect encapsulated compounds against destructive effects of light, heat, moisture and oxygen [10,11–13]. Due to the hydrophilicity of the yeast membrane, permeation of hydrophilic compounds is mechanistically facilitated [10]. However, encapsulation efficiency of the yeast cells may be affected, especially for fat-soluble compounds [11,12,14].

Modification methods have been developed to increase the yeast encapsulation efficiency and loading capacity [15]. It has been reported that mechanical disruption of cell walls by ultrasonication can lead to increased encapsulation efficiency by discharging the intracellular compounds into the surrounding media [11,13,15]. Use of chemical and biochemical methods is interested for the cell wall treatment. These are included in the utilization of chemicals or enzymes to alter the yeast cell wall. Yeast cell autolysis by endogenous enzymes is a process triggered by activating intracellular enzymes [11,13,15]. Glucanase and proteinase are the major enzymes contributing to disrupt-tion of the cell wall; through which, the cell wall becomes porous and crumpled leading to the release of intracellular compounds into the environment [11,16]. Moreover, plasmolysis is a chemical process, which provides a hyper-tonic environment in the presence of chemicals such as sodium chloride, toluene and ethanol [11,16,17]. It is addressed that pretreat-ment of yeast cells by plasmolysis using NaCl leads to increased encapsulation of cholecalci-ferol (vitamin D3) [13]. Similar results were observed after plasmolysis of yeast cells for encapsulation of purslane seed oil [15]. In recent years, bread enrichment with folic acid has been carried out as a national strategy in Iran [18]. However, susceptibility of folic acid to high temperatures of bread baking is highly concerned. No study has been carried out on efficiency of treated yeast cells in protection of folic acid under thermal process and during storage of breads. For the first time, this study aimed to treat cells of S. cerevisiae using plasmolysis, autolysis and ultrasonica-tion as carrier of folic acid for enrichment of two types of Iranian bread (lavash and barbari). Morphology of the cells, encapsulation efficiency (EE), loading capacity (LC), thermal behaviors and stability of encapsulates during baking and storage of the bread were assessed in the study.

  1. Materials and Methods

2.1. Materials

The S. cerevisiae cells were provided from Fariman, Mashhad, Iran. All chemicals, including phosphate buffer, were purchased from Sigma Aldrich, USA. Sodium hydroxide and hexane were purchased from Merck, Germany.

2.2. Preparation of non-treated yeast cells

Briefly, 170 g of S. cerevisiae cells were washed with phosphate buffer (pH 6.8) and centrifuged at 3984× g for 10 min. Then, cells were rinsed five times with deionized water. Cells were freeze-dried and stored at 4 °C for further experiments [15].

2.3. Yeast cell plasmolysis

Generally, 100 g of the prepared yeast cells were suspended in 1000 ml of NaCl solution (10% w v-1) and incubated at 55 °C for 48 h at 180 rpm. Then, plasmolyzed cells were rinsed with deionized water five times to separate the residual NaCl solution. Washed yeast cells were freeze-dried and stored at 4 °C for further analyses [15].

2.4. Yeast cell autolysis

Yeast cell suspension (15% wv-1) was prepared and pH was adjusted to 5.5 using HCl solution (4 N). To autolyze the yeast cells, 100 ml of the suspension were agitated for 48 h at 55 °C using shaking incubator. Autolyzed cells were centrifuged at 8000× g for 20 min [11].

2.5. Yeast cell ultrasonication

Yeast cell suspension (0.5 g/100 ml) was subjected to an ultrasonic bath (maximum power of 750 W, frequency of 20 kHz) and 20% of power were applied for 60, 180 and 300 s (10 s on-10 s off). Then, cells were accumulated by centrifugation at 4000× g for 5 min at 30 °C. The biomass was collected and assessed for further analyses [11].

2.6. Encapsulation of folic acid within plasmolyzed, autolyzed and ultrasonicated cells

Briefly, 10 g of folic acid were added to 40 ml of deionized water and mixed well using ultra-turrax (Turrax IKA T25-Digital Ultra, Germany) at 11800 g for 5 min. Ice bath was used to control the temperature. Then, intact, plasmolyzed, autolyzed and ultrasonicated yeast cells were separately added to the vitamin solution at 2:1 (w w-1) based on pre-experiences and then incubated at 40 °C for 12 h with a 180-rpm agitation rate. Then, folic acid-loaded yeast cells were centrifuged at 8965× g for 15 min and rinsed with deionized water to eliminate the residual non-loaded vitamin. Folic acid -loaded yeast cells were freeze-dried at -80 °C for 14 h and stored at 4 °C for further uses [19-21].

 

2.7. Assessment of efficiency and loading capacity

In general, 10 mg of folic acid-loaded yeast cells were suspended in 5 ml of 0.1-N NaOH, stirred for 15 min and then ultrasonicated under output power of 0 400 W and output frequency of 20 kHz with a titanium horn with diameter of 13 mm (Model UHP-400, Lithuania) for 2 min at room temperature (RM) in three cycles of 50% amplitude. Treated suspension was filtered using Whatman filter papers of 11 μm (Whatman, USA). Then, 1 ml of the filtrate was made up to 10 ml with distilled water (DW) and incubated at 37 °C. To assess concentration of encapsulated folic acid, absorbance of the final solution was measured using UV-vis spectrophotometer (WPA S2000 Lightwave, Ireland) at 306 nm. Furthermore, NaOH solution (0.1 N) was used as blank. Concentration of folic acid was assessed using calibration curve. The EE (%) and LC (%) were assessed using Eqs. 1 and 2 as follows:

 

                                                                                                                                                                                                                               Eq. 1

                                                                                                                                                                                                                                Eq. 2

2.8. Microstructure analysis

Microstructure of folic acid-loaded yeast cells was firstly investigated using scanning electron microscopy (SEM) (Oxford Instruments INCA Penta FET × X3, Chapel Hill, USA) [19]. The microencapsulated folic acid powder was adhered to aluminum stand using silver glue. Samples were coated using gold metallizer. Imaging was carried out using electron beam accelerator of 25 kV at ambient temperature. Additional studies on morphological charac-teristics were carried out using transmission electron microscopy (TEM) (Zeiss EM900, Carl Zeiss, Thornwood, USA) [12]. Samples were immerged in glutaraldehyde solution (3% vv-1) overnight. Then, these were washed and centrifuged at 4500× g, followed by suspending in molten agarose (2%). After solidification, agarose gels containing the samples were cut into cubes and transferred into osmium tetroxide (1%) for 60 min, followed by washing with 0.1-M phosphate buffer (pH 7.2). These were dehydrated with ethanol at gradient concentration (25–100% vv-1) and acetone. Then, cubes were embedded in Spurr’s resin. Cubes were cut into thin layers with 80-nm thicknesses with a RMC MT-7000 ultramicrotome, stained with uranyl acetate and lead citrate and then studied at 50 kV using TEM [13].

2.9. Thermal analysis

Thermal behaviors of the yeast cells were studied using differential scanning calorimetry (DSC) (Shimadzu DSC-60, Japan) [17]. Samples (6–12 mg) were transferred into aluminum pans, tightly sealed and heated from 25 to 300 °C at a scanning rate of 10 °C min-1. Nitrogen was used as a purge gas at a flow rate of 30 ml min-1.

2.10. Stability of folic acid in breads

Stability of folic acid in breads after baking and during storage (after 24 h for barbari and after 24, 48 and 72 h for lavash) was assessed using high-performance liquid chromatography (HPLC) (Model 7000, Merck-Hitachi, Darmstadt, Germany) equipped with a fluorescence detect-or (Model 7485, LaChrom, Merck-Hitachi, Darmstadt, Germany). A LiChrosphere100 RP-18 (5 mm) column (Merck, Darmstadt, Germany) was used to separate the compounds. Column was eluted with gradient concentra-tions of acetonitrile and 30 mmol l-1 phosphate buffer at pH 2.2 [potassium phosphate and ortho-phosphoric acid (85%), 10:1] at a flow rate of 0.9 ml min-1. The gradient program was started at 6% acetonitrile. Then, isocratic concentration of 6% was used for 6 min, followed by increasing to 25% acetonitrile until 24 min. At the end of the process, concentration of acetonitrile decreased to 6% after 5 min. Injection volume included 40 ml. The running time was 30 min and the injection interval was 40 min. Fluorescence absorbance at excitation and emission wavelengths of respectively 280 and 350 nm was used to quantify folic acid [16].

2.11. Statistical analysis

Data were analyzed using SPSS software v.22 (IBM, USA). All experiments were repeated three times. Compar-ison of means was carried out using one-way ANOVA followed by Duncan test to report significant differences at a confidence level of 95%.

 

  1. Results and Discussion

3.1. Effects of plasmolysis, autolysis and ultrasonication on encapsulation efficiency and loading capacity

In general, S. cerevisiae has attracted great attentions in microencapsulation [10]. Use of modifications on yeast cells has demonstrated positive effects on the EE [22]. Discharging the contents of yeast cells can increase space needed for entrapping. Plasmolysis, autolysis and ultr-asonication can provide necessary space for the entrapment of bioactive ingredients by driving the cell components outside [11,13]. Effects of cell wall treatments on EE and LC are present in Table 1. For folic acid-loaded intact cells, EE and LC were significantly lower than those for treated yeast cells. It was associated with the altering effects of the treatments on the cell wall, leading to leakage of intracellular compounds for providing further spaces for core loading [13]. Chemical treatment of yeast cells leads to the increased permeability [19,23,24]. Due to the inter-molecular interactions of mannoproteins, the hydrophobic linkages and disulfide bonds are responsible for the cell wall porosity. Physical and chemical treatments can destroy these intermolecular network; through which, it promotes permeability of the S. cerevisiae cells [23]. In comparison, ultrasonication affects the permeability by rupturing the cell wall through the microstreaming and bubble cavitation, causing shear stress on the cell wall [25]. In a previous study, β-carotene was encapsulated with Yarrowia lipolytica cells using improvement of the core entrapment and sonication [25]. Use of ultrasound, as a green physical treatment, significantly increased the β-carotene encapsulation efficiency in yeast [25]. In the current study, autolysis was the most efficient treatment for encapsulation of folic acid, followed by plasmolysis and sonication. Indigenous hydrolyzing enzymes in the yeast cells change the cell wall structure to provide available space for the entrapment of bioactive compounds. As seen in Table 1, EE and LC of autolysis were higher than those of other external chemical (plasmolysis) and physical (ultrasonication) forces.

3.2. Microstructure and morphology of folic acid-loaded yeast cells

Morphology of folic acid-loaded intact and treated yeast cells was assessed using SEM (Fig. 1). As illustrated in Fig. 1a, intact yeast cells were agglomerated, while plasmolysis, autolysis and ultrasonication increased the cell distances, resulting in separation of the cells (Figs. 1b–d). After plasmolysis, contraction of cell wall resulted in the formation of further spaces between the cells. Furthermore, separation after autolysis was possibly due to the repulsive forces of the cells as a result of accumulation of similar charges on the cell surface in the acidic environment. In addition, the accumulated intact cells were disrupted after ultrasonication through the cavitations process. Nonetheless, discharging cells from internal components possibly led to alteration of the surface and physical hindrance. Relatively, no significant change was observed in integrity of the plasmolyzed yeast cells used for encapsulation of Gallic acid [26]. Similarly, purslane seed oil-loaded non-plasmolyzed, plasmolyzed and plasmolyzed CMC-coated yeast cells included spherical shape and no cracking, deformity or rupture was observed in their SEM images. The authors reported that plasmolysis did not change the integrity of yeast cells [15].

Figure 2 shows TEM images of the non-loaded and loaded intact and treated cells. As seen in the figure, folic acid was successfully entrapped in the yeast cells. The lowest entrapment was observed for the intact cells followed by the ultrasonicated cells (Table 1). Furthermore, treatment of the cells did not change the cell integrity and no inconformity was seen in the treated cells.

3.3. Differential scanning calorimetry

Thermal behaviors of free folic acid and the loaded intact, plasmolyzed, autolyzed and ultrasonicated cells are illustrated in Fig. 3. Folic acid showed a constant thermal behavior until 220 °C and an endothermic dip was detected at 230 °C, which could be linked to the degradation of the vitamin [26]. For the loaded yeast cells, an endothermic dip was detected at 60–70 °C, which was attributed to the protein denaturation. Similarly, an endothermic dip at 67.87 °C was observed by Cruz-Gavia et al. in study of thermal behavior of S. cerevisiae cells. The authors believed that protein molecules of the cells denatured in this area [27]. In addition, gelatinization of β-D-glucan might show an endothermic dip at nearly 52 °C [28]. Despite no evidence of degradation at higher temperatures (Figs. 3b–e), degradation of the phospholipid bilayer and yeast cells was usually occurred at higher temperatures (160 and 265 °C) [19]. Interestingly, intact cells showed a sharper endothermic dip in the region (Fig. 3b), compared to the treated cells that might be attributed to its higher protein contents.  

3.4. Vitamin stability

Stability of folic acid within treated and non-treated yeast cells in Iranian breads of lavash and barbari was assessed (Table 2). Breads include various shelf lives in the environment. Barbari is a semi-volume bread and it stales after 24 h at ambient temperature. In comparison, the flat bread of lavash can be stored up to 3 d in the environment. Therefore, the two types of bread were studied under various times. Before baking (dough), the highest quantity of folic acid was preserved in L1, L3 and B1 while the lowest quantity was achieved in L2 and B4. After baking (0 h), the highest folic acid preservation in barbari was achieved in B1 and B2. Similar results were observed after 24 h; thus, breads containing folic acid-loaded autolyzed cells showed the best vitamin preservation. This was similar to the results of lavash breads; in which, folic acid-loaded autolyzed cells included the best vitamin preservation followed by folic acid-loaded plasmolyzed and ultrasonicated cells after baking and until the end of storage. Concentrations of folic acid in dough and breads showed significant differences. This verified the need of protective strategies for better preservations of the vitamin to avoid its significant losses under the processes. Similar results were reported by other studies. Ashkezary et al. enriched Iranian breads with encapsulated riboflavin in plasmolyzed and non-plasmolyzed yeast cells; through which, a better protection of the encapsulated vitamin was seen after baking and during storage of the breads, compared to free riboflavin. In their study, a better protection was detected in the plasmolyzed yeast cells [10]. Microencapsulation of limonene by yeast cells can protect it after drying and heavy washing with hexane [29]. Using the yeast cells for microencapsulation of polyunsaturated fatty acids (PUFA) led to a better protection against high temperatures and oxidation [21]. Similarly, higher preservations of cholecalciferol (vitamin D3) after exposure to simulated gastrointestinal tract (GIT) was reported through its encapsulation with yeast cells [30]. Neves et al. studied the thermal stability of folic acid in fortified French breads. Based on their results, a less loss of folic acid was seen in breads containing encapsulated vitamin, compared to that observed in breads with free folic acid (degradation started at 100 °C and completed at 155 °C after 30 min or 175 °C after 5 min for free folic acid, while it started at 40 °C and completed at 100 °C after 15 min for encapsulated folic acid). It was suggested that folic acid dispersion on the surface of the microcapsule caused their faster degradation, compared to free vitamins [31].

Villela et al. studied potentials of starch and polyethylene glycol for the encapsulation of folic acid. Accordingly, folic acid was successfully encapsulated within the polymers, but sizes of the particles varied 18–45 µm based on the type of starch (corn, potato and rice). In simulated gastric fluid, a partial degradation of polyethylene glycol (30–37%) was seen, while starch-folic acid core was intact. Moreover, a 50% degradation in polyethylene glycol was observed in simulated intestinal fluid. Degradation of polyethylene glycol provided controlled gradual releases of folic acid in the simulated gastrointestinal environment [32]. Yingleardr-attanakul et al. investigated folic acid fortification of rice vermicelli using various encapsulation techniques of gel particle, complex coacervation and spray drying. In their study, pectin and sodium alginate were used for the entrapment of the vitamin. The authors detected that spray drying was the most appropriate technique for folic acid encapsulation in rice vermicelli because spray dried particles were acid-soluble but water-insoluble; thus, preventing the loss of folic acid during processing [33].

  1. Conclusion

Microencapsulation of folic acid via plasmolyzed, autolyzed and ultrasonicated yeast cells improved the encapsulation efficiency and loading capacity. Microstructure analysis of the loaded cells showed the dissociation effect of the treatments; therefore, cell dispersity increased in the treated cells, compared to the intact cells. Moreover, TEM images showed that treatment of the cells did not include disrupting effects on the cell structure. Stability experiments showed that encapsulation of folic acid by the treated cells included positive effects on the vitamin preservation after baking and during storage. Autolysis showed the most protection rate, followed by plasmolysis and ultrasonication. It is suggested that further studies use bioactive compounds and encapsulate them inside the yeast cells.

  1. Acknowledgements

The authors acknowledge the laboratory staff of Varamin-Pishva Branch, Islamic Azad University.

  1. Conflict of Interest

The authors declare no conflict of interest.

  1. Authors Contributions

AM, Fund acquisition, formal analysis, resource provid-ing, data curation, writing and original drafting; LN, methodology, data curation, validation, investigation, supervision and project administration; MM, conceptual-ization, data curation, writing, review and editing the final draft and visualization; MH, text editing and manuscript checking for grammar.

References

  1. Zarei F, Nateghi L, Eshaghi MR, Ebrahimi TAJ Abadi M. Production of gamma-aminobutyric acid (GABA) in whey protein drink during fermentation by Lactobacillus plant-arum. J Microbiol Biotechnol Food Sci. 2020; 9(6): 1087-1092.

https://doi.org/ 10.15414/jmbfs.2020.9.6.1087-1092

  1. Zarei F, Nateghi L, Eshaghi MR, Ebrahimi TAJ Abadi M. Optimization of gamma-aminobutyric acid production in probiotics extracted from local dairy products in west region of Iran using MRS broth and whey protein media. Appl Food Biotechnol. 2018; 5(4): 233-242.

https://doi.org/10.22037/afb.v5i4.22360  

  1. Mohammed AS Y, Dyab AKF, Taha F, Abd El-Mageed AIA. Encapsulation of folic acid (vitamin B9) into sporopollenin microcapsules: Physico-chemical characterisation, in vitro controlled release and photoprotection study. Mater Sci Eng C Mater Biol Appl. 2021; 128.

https://doi.org/10.1016/j.msec.2021.112271

  1. Gazzali AM, Lobry M, Colombeau L, Acherar S, Azaïs H, Mordon S, Arnoux P, Baros F, Vanderesse R, Frochot C. Stability of folic acid under several parameters. Eur J Pharm Sci. 2016; 10(93): 419-430.

https://doi.org/10.1016/j.ejps.2016.08.045

  1. Sheybani F, Rashidi L, Nateghi L, Yousefpour M, Mahdavi S Kh. Application of nanostructured lipid carriers containing α-tocopherol for oxidative stability enhancement of camelina oil. Ind Crops Prod. 2023; 202 (117007): 1-12.

https://doi.org/10.1016/j.indcrop.2023.117007

  1. Delchier N, Herbig A, Rychlic M, Renard C. Folates in fruits and vegetables: contents, processing and stability. Compr Rev Food Sci Food Saf. 2016; 15: 506-528.

https://doi.org/10.1111/1541-4337.12193

  1. Aceituno-Medina M, Mendoza S, Lagaron JM, López-Rubio A. Photoprotection of folic acid upon encapsulation in food-grade amaranth (amaranthus hypochondriacus L.) protein isolate-Pullulan electrospun fibers. LWT- Food Sci Technol. 2015; 62(2): 970-975.

https://doi.org/10.1016/j.lwt.2015.02.025

  1. Alborzi S, Lim LT, Kakuda Y. Release of folic acid from sodium alginate-pectin-poly (ethylene oxide) electrospun fibers under in vitro conditions . LWT- Food Sci Technol. 2014; 59(1): 383-388.

https://doi.org/10.1016/j.lwt.2014.06.008

  1. Rezvankhah A, Emam-Djomeh Z, Askari G. Encapsulation and delivery of bioactive compounds using spray and freeze-drying techniques: A review. Dry Technol. 2020; 38(1-2): 235-258.

https://doi.org/10.1080/07373937.2019.1653906

  1. Ashkezary E, Vazifedoost M, Nateghi L, Didar Z, Moslemi M. Stability of riboflavin microencapsulated in yeast Saccharomyces cerevisiae cells in iranian bread (lavash and barbari). Iran J Chem Chem Eng. 2024; 43(1): 314-326.

https://doi.org/10.30492/ijcce.2023.1987100.5808

  1. Takalloo Z, Nikkhah M, Nemati R, Jalilian N, Sajedi RH. Autolysis, plasmolysis and enzymatic hydrolysis of baker's yeast (Saccharomyces cerevisiae): A comparative study. World J Microbiol Biotechnol. 2020; 24;36(5): 68.

https://doi.org/10.1007/s11274-020-02840-3

  1. Shi G, Rao L, Yu H, Xiang H, Yang H, Ji R. Stabilization and encapsulation of photosensitive resveratrol within yeast cell. Int J Pharm. 2008; 349(1-2): 83-93.

https://doi.org/10.1016/j.ijpharm.2007.07.044

  1. Dadkhodazade E, Mohammadi A, Shojaee-Aliabadi S, Mortazavian AM, Mirmoghtadaie L, Hosseini SM. Yeast cell microcapsules as a novel carrier for cholecalciferol encapsulation: Development, characterization and release properties. Food Biophys. 2018; 13: 404-411.

https://doi.org/10.1007/s11483-018-9546-3

  1. Krishnan PN, Saraswathi R, Dilip C, Ramarao N. Formulation and evaluation of acyclovir microcapsules using bakers yeast. Asian Pac J Trop Med. 2010; 3(6): 454-457.

https://doi.org/10.1016/S1995-7645(10)60109-5

  1. Kavosi M, Mohammadi A, Shojaee-Aliabadi S, Khaksar R, Hosseini SM. Characterization and oxidative stability of purslane seed oil microencapsulated in yeast cells biocapsules. J Sci Food Agric. 2018; 98(7): 2490-2497.

https://doi.org/10.1002/jsfa.8696

  1. López-Nicolás R, Frontela-Saseta C, González-Abellán R, Barado-Piqueras, A, Perez-Conesa, D, Ros-Berruezo G. Folate fortification of white and whole-grain bread by adding Swiss chard and spinach. Acceptability by cons-umers. LWT- Food Sci and Technol. 2014; 59(1): 263-269.

https://doi.org/10.1016/j.lwt.2014.05.007

  1. Dadkhodazade E, Khanniri E, Khorshidian N, Hosseini SM, Mortazavian AM, Moghaddas Kia E. Yeast cells for encapsulation of bioactive compounds in food products: A review. Biotechnol Prog. 2021; 37(4): 1-12.

https://doi.org/10.1002/btpr.3138

  1. Mahdavi-Roshan M, Ramezani A. Overview of flour

fortification program with Iron and folic acid in iran. J Health Res Commun. 2017; 3(1): 57-68.

https://dori.net/dor/20.1001.1.24236772.1396.3.1.7.5

  1. Paramera EI, Konteles SJ, Karathanos VT. Microencaps-ulation of curcumin in cells of Saccharomyces cerevisiae. Food Chem. 2011; 125(3): 892-902.

https://doi.org/10.1016/j.foodchem.2010.09.063

  1. Dong LM, Hang HTT, Tran NHN, Thuy DTK. Enhancing the viability rate of probiotic by coencapsulating with pre-biotic in alginate microcapsules supplemented to cupcake production. microbiol. Biotechnol Lett. 2020; 48(2): 113-120

https://doi.org/10.4014/mbl.1910.10015

  1. Beikzadeh S, Shojaee-Aliabadi S, Dadkhodazade E, Sheidaei Z, Abedi AS, Mirmoghtadaie L, Hosseini SM. Comparison of properties of breads enriched with omega-3 oil encapsulated in β-glucan and Saccharomyces cerevisiae yeast cells. Appl Food Biotechnol. 2020; 7(1): 111-120

https://doi.org/10.22037/afb.v7i1.25969

  1. Sheybani F, Rashidi L, Nateghi L, Yousefpour M, Mahdavi SKh. Development of ascorbyl palmitate-loaded nanostruc-tured lipid carriers (NLCs) to increase the stability of camelina oil. Food Biosci. 2023; 53(102735): 1-11.

https://doi.org/10.1016/j.fbio.2023.102735

  1. Shi G, Rao L, Xie Q, Li J, Li B, Xiong X. Characterization of yeast cells as a microencapsulation wall material by fourier-transform infrared spectroscopy. Vib Spectrosc. 2010; 53(2): 289-295.

https://doi.org/10.1016/j.vibspec.2010.04.007

  1. Czerniak A, Kubiak P, Białas W, Jankowski T. Improvement of oxidative stability of menhaden fish oil by microencapsul-ation within biocapsules formed of yeast cells. J Food Eng. 2015; 167(2): 2-11.

https://doi.org/10.1016/j.jfoodeng.2015.01.002

  1. Pham-Hoang BN, Romero-Guido C, Phan-Thi H, Waché Y. Strategies to improve carotene entry into cells of Yarrowia lipolytica in a goal of encapsulation. J Food Eng. 2018; 224: 88-94.

https://doi.org/10.1016/j.jfoodeng.2017.12.029

  1. Karaman K. Fabrication of gallic acid loaded yeast (Saccharomyces cerevisiae) microcapsules: Effect of plasmolysis treatment and solvent type on bioactivity and release kinetics. LWT- Food Sci. Technol. 2021; 148 (111640): 1-37.

https://doi.org/10.1016/j.lwt.2021.111640

  1. De la Cruz-Gavia A, Pérez-Alonso C, Barrera-Díaz CE, Alvarez-Ramírez J, Carrillo-Navas H, Guadarrama-Lezama AY. Survival of Saccharomyces cerevisiae microencaps-ulated with complex coacervate after freezing process. Food Hydrocoll. 2018; 82: 45-52.

https://doi.org/10.1016/j.foodhyd.2018.03.045

  1. Marson GV, Saturno RP, Comunian TA, Consoli L, da Costa Machado MT, Hubinger MD. Maillard conjugates from spent brewer’s yeast by-product as an innovative encapsulating material. Int Food Res J. 2020; 136: 109365.

https://doi.org/10.1016/j.foodres.2020.109365

  1. Errenst C, Petermann M, Kilzer A. Encapsulation of limonene in yeast cells using the concentrated powder form technology. J Supercrit Fluid. 2021; 168(105076):

https://doi.org/10.1016/j.supflu.2020.105076

  1. Dadkhodazade E, Mohammadi A, Shojaee-Aliabadi S, Mortazavian AM, Mirmoghtadaie L, Hosseini SM. Yeast cell microcapsules as a novel carrier for cholecalciferol encapsulation: development, characterization and release properties. Food Biophys. 2018; 13: 404-411.

https://doi.org/10.1007/s11483-018-9546-3

  1. Neves DA, Lobato K, Angelica RS, Filho JT, Oliveira G, Godoy HT. Thermal and in vitro digestion stability of folic acid in bread. J Food Compos Anal. 2019; 84(103311): 1-9.

https://doi.org/10.1016/j.jfca.2019.103311

  1. Villela K, Galindo R, Neira R, Solis V, Garcia-Casillas P. Stability of starch-folic acid/ polyethylene glycol particles for gastrointestinal drug delivery. Food Hydrocoll. 2024; 157(110318): 1-10.

https://doi.org/10.1016/j.foodhyd.2024.110318

  1. Yingleardrattanakul Ph, Thompson AK, Taprap R, Pinsirodom P, Bindu SC. Evaluation of the efficiency of various folic acid microencapsulation techniques for rice vermicelli (khanom jeen) fortification. Food & Humanity. 2024; 2(100198): 1-20.

https://doi.org/10.1016/j.foohum.2023.12.006

 



Assessment of Probiotic Characteristics of Lactiplantibacillus plantarum SU-KC1a Isolated from Human Breast Milk in Indonesia

Marcelia Sugata, Youngchae Kim, Athiyyarizka Farbila Rachmah, Jesslyn Oei, Emily Tania Purnama, Apdrie Calyca Jacquiline Nitbani, Hans Victor, Juandy Jo, Tjie Jan Tan

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e31
https://doi.org/10.22037/afb.v11i1.45707

Background and Objective: Lactic acid bacteria such as Lactiplantibacillus spp. and Bifidobacterium spp. are addressed for their beneficial characteristics. This study aimed to assess probiotic attributes of Lactiplantibacillus plantarum SU-KC1a isolated from human breast milk in Indonesia.

Material and Methods: Lactiplantibacillus plantarum SU-KC1a was anaerobically isolated from human breast milk and then morphologically and biochemically characterized. Probiotic characteristics, including tolerance to various pH levels and bile salt concentrations, antibiotic susceptibility, antimicrobial activity, mucosal adhesion ability and oxidative stress tolerance, were assessed.

Results and Conclusion: Lactiplantibacillus plantarum SU-KC1a exhibited rod-shaped, Gram-positive staining, negative catalase activity, and lacked acid-fastness and motility. Under stress conditions, this strain adopted a coccoid-like shape to protect its cell membrane and internal structures from external environments. Significantly, it demonstrated resistance to mupirocin, distinguishing it from other lactobacilli. The strain showed enhanced growth in the presence of prebiotics, particularly galactooligosaccharides. Additionally, it showed probiotic characteristics such as robust tolerance to pH variations and bile salts, potent antimicrobial activity against pathogens, strong adherence to mucosal surfaces and resistance to oxidative stress. These findings highlight Lactiplantibacillus plantarum SU-KC1a as a promising probiotic candidate appropriate for incorporation into functional foods.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Breast milk is renowned for its rich composition of essential nutrients, bioactive compounds and antibodies critical for infant growth and immune development. It contains a spectrum of elements, including carbohydrates, proteins, antibodies, vitamins, minerals and amino acids (notably L-arginine), making it a perfect natural nourishment for infants [1]. Studies have consistently highlighted advantages of breastfeeding, showing a lower susceptibility to infections and gastrointestinal disorders in breast-fed neonates, partly due to the presence of probiotics in breast milk [1, 2]. From these probiotics, lactic acid bacteria (LAB) such as Lactiplantibacillus spp. and Bifido-bacterium spp. are particularly prominent for their beneficial effects on the infants’ immune system. Naturally, LAB play their significant roles in promoting human health by stimulating proliferation and differentiation of the host intestinal cells, regulating acidity in the gastrointestinal tract (GIT) and competing with harmful pathogens [3].

Breast milk contains prebiotics known as human milk oligosaccharides to increase growth and viability of LAB. Importance of prebiotics in breast milk is signified in industrial practices, where prebiotics are intentionally introduced to functional foods to support LAB growth and viability. This integration of prebiotics and probiotics in food production serves to nourish beneficial bacteria, enhancing their survival and functionality.

Oligosaccharides widely used as prebiotics in food industries include fructooligosaccharides (FOS) and galactooligosaccharides (GOS), lactose, isomaltooligo-saccharides, xylooligosaccharides, maltodextrin and inulin [4]. In addition to its prebiotic characteristics, inulin is used to improve the quality of milk fermented by Lactobacillus acidophilus and Bifidobacterium lactis [5]. Although addition of prebiotics can stimulate growth of LAB, those used in food industries often facing challenging environ-ments, resulting in decreased viabilities during processing and storage. As many LAB are facultative anaerobes or microaerophiles, they are highly susceptible to oxidative stress. Zhai et al. [6] reported that the growth of L. plantarum strain CAUH2 decreased when exposed to hydrogen peroxide. Another study by Dosan et al. [7] revealed that B. animalis subsp. lactis BR2-5 and B. breve BS2-PB3 cells were significantly depleted when exposed to oxygen, with no viable cells detected under aerobic conditions.

Categorized as probiotics, microorganisms must with-stand stressful conditions, exhibit survival capability within GIT, show effective adherence to intestinal epithelia and be safe for animals and humans [8]. Adherence of probiotic bacteria to the intestinal lining includes particular significance due to its role in the bacterial survival within the dynamic digestive tract environment. Colonization, a critical aspect of this survival, is facilitated through bacterial adhesion to the intestinal wall [9]. Additionally, LAB, specifically L. plantarum strain WLPL04 isolated from human breast milk (HBM), has been reported for its capacity to prevent adhesion of pathogenic bacteria via competitive mechanisms. These inhibitory effects have been demonstrated in vitro against pathogens such as Escherichia coli O157:H7, Salmonella Typhimurium ATCC13311 and Staphylococcus aureus CMCC26003 [10].

Despite extensive global studies on probiotic potential of LAB, a significant gap remains in understanding their isolation and characterization from HBM samples across diverse geographical regions. Studies focusing on LAB from HBM in various regions of the world, including Indonesia, are significantly limited. This gap is critical as regional variations in microbial composition can affect beneficial characteristics of LAB, especially in promoting maternal-infant health. Addressing this gap is essential for gaining a comprehensive understanding of LAB diversity and their potential uses in nutrition and health worldwide. Therefore, this study aimed to isolate and characterize LAB strains from HBM samples in Indonesia. Through compre-hensive biochemical profiling, molecular identification, assessment of growth capabilities on prebiotic substrates and assessment of the probiotic attributes of the identified strains, this study provided an overview of potential probiotic stains from HBM that could improve public health globally.

  1. Materials and Methods

2.1. Isolation and identification

2.1.1 Subjects and ethical issue

All procedures were approved by the Ethical Committee of Rumah Sakit Anak dan Bunda Harapan Kita, Jakarta, Indonesia (922/2020 on 03/31/2020) and all the volunteers signed written informed consents. Overall, two healthy women with no underlying conditions or complications participated in this study. They provided breast milk samples 1–2 d after their caesarean deliveries.

2.1.2 Sample collection

Sampling method was adapted from Eglash and Simon [11] with some modifications. All the equipment for sampling were sterilized for 10 min in boiling water and dried at room temperature (RT) before use. Nipples and mammary areola were cleaned with sterile water and cotton soaked in chlorhexidine (0.1%). The first drops were discarded, then the milk samples were collected using electric breast pump (Real Bubee, UK) and then transferred to sterile breast-milk storage bags. All samples were stored in a cool box with ice packs during transport to the laboratory.

2.1.3 Media

Two different media were used in this study, including de Man, Rogosa and Sharpe (MRS) (Liofilchem, Italy) and trypticase phytone yeast extract (TPY). One liter of TPY broth was prepared by mixing 17.6 g of tryptone soya broth (TSB) (Oxoid, UK), 5 g of peptone (Merck, USA), 5 g of glucose (Merck, USA), 2.5 g of yeast extract (Merck, USA), 1 ml of Tween-80 (Merck, USA) and 2 g of dipotassium phosphate (Merck, USA) in distilled water (DW). The two media were modified by the addition of L-cysteine (2.5 g/l) (Nowfood, USA) and mupirocin (0.05 mg/ml) (Genero, UK). Modified MRS and TPY were referred to as mMRS and mTPY, respectively. To prepare solid media, 1.5% bacteriological agar was added to the media.

2.1.4 Isolation of lactic acid bacteria

Milk samples were diluted using sterile peptone water (0.1%) (Merck, Germany) and spread-plated (50 µl) on media. To support growth of LAB at the isolation stage, mMRS agar supplemented with 30% pasteurized cow milk (Greenfields, Indonesia) was used. All plates were incubated at 37 oC for 96 h in an anaerobic jar (Oxoid, UK) with anaerobic atmosphere generator sachets (Oxoid, UK). After incubation, a colony was selected and purified using four-way streak method with the purified isolate referred to as SU-KC1a.

2.1.5 Molecular identification and phylogenetic analysis

For molecular identification, isolate was processed by PT Genetika Science Indonesia for Species Barcoding (DNA extraction, 16S rRNA gene amplification and molecular identification based on 16S rRNA sequence). The PCR reactions were prepared using universal primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′). The 16S rRNA sequence was analyzed using Basic Local Alignment Search Tool (BLASTN 2.12.0+). Then, a phylogenetic tree was constructed using MEGA 11. MUSCLE alignment was carried out and a maximum likelihood phylogenetic tree was constructed. Bootstrap values were set at 1000 replicates. Sequences of other microorganisms used in the phylogenetic tree were retrieved from GenBank.

2.2 Characterization

2.2.1 Morphological study and biochemical activity test

           The isolate was characterized based on morphology (Gram and acid-fast staining), motility and biochemical activity (catalase test). To assess effects of oxygen on cell morphology, the isolate was cultured on mMRS agar plates and incubated at 37 °C for 72 h under microaerophilic and anaerobic conditions. Furthermore, its capacity to thrive under various oxygen levels, encompassing microaerophilic and anaerobic conditions, was assessed.

2.2.2 Mupirocin resistance test

           Since the isolation procedure involved a medium supplemented with mupirocin, resistance of the isolate to mupirocin was assessed. For comparison, Lactiplacti-bacillus plantarum F75 from the Biology Department culture collection at Universitas Pelita Harapan was used. This strain was originally isolated from the chicken crop. The two bacterial strains were cultured on mMRS agar at 37 °C, under anaerobic and microaerophilic conditions. Following a 72-h incubation time, growth of the strains on agar plates was recorded.

2.2.3 Carbohydrate fermentation test

           The isolate ability to ferment various carbohydrates was analyzed using a method described by Dosan et al. [7]. For this test, MRS broth without carbon source was prepared manually by mixing 2.5 g of L-cysteine, 0.05 g of mupirocin, 10 g of peptone, 4 g of yeast extract, 8 g of beef extract, 5 g of NaCl, 2 g of di-ammonium hydrogen citrate, 0.2 g of MgSO4.7H2O, 2 g of FeSO4·7H2O, 0.04 g of MnSO4.7H2O and 1 g of Tween 80 in 1 l of sterile water and mixed. Then, 2% carbohydrate was added to the mixture; this medium was then referred to as MRSP broth. The MRS broth without carbon sources served as the negative control. Carbohydrates included glucose (Merck, USA), fructose (Merck, USA), lactose (Merck, USA), fructo-oligosaccharide (FOS; Xi’an Virgin Biotechnology, China), GOS (Xi’an Virgin Biotechnology, China), inulin (Beneo, Germany) and maltodextrin (Qinhuangdao Lihua Starch, China). To monitor acid production, pH indicator of bromocresol purple (30 mg/L) (Merck, Germany) was added to all media. Isolate was inoculated into MRSP broth and incubated anaerobically at 37 °C for 24 h. The isolate ability to ferment carbohydrates was indicated by a drop in pH, resulting in color change of the medium to yellow. Additionally, the total viable cell count was carried out by serially diluting the liquid culture using 0.1% bacteriological peptone. Then, a 50-μl aliquot of the diluted liquid culture was spread onto MRSP agar plates and incubated at 37 °C for 72 h. Colony forming unit (CFU) was used to assess the bacterial growth in presence of various prebiotics. Results were present as relative growth percentage, with bacterial growth in MRS without carbohydrate serving as the reference point for comparison. Relative growth percentage (%) included ratio of bacterial growth in presence of prebiotics to its growth in absence of prebiotics.

2.3 Assessment of probiotic characteristics

2.3.1 Tolerance to various pH levels and various concentrations of bile salts

           Assessment of the isolate tolerance to various pH levels and bile salt concentrations was carried out using a modified method from Khushboo et al. [12]. The isolate was cultured overnight in mTPY broth. Then, a 10% inoculum of the liquid culture was added to mTPY broth adjusted to various pH levels (2, 4, 7 and 9) or various bile salt concentrations (0, 0.5, 1 and 2%). All tubes were incubated anaerobically at 37 °C for 3 h. To assess total viable cell, an aliquot of 50 µl was withdrawn before and after incubation and then spread onto mTPY agar plates. All plates were incubated anaerobically at 37 °C for 72 h.

2.3.2 Antibiotic susceptibility

           To assess isolate susceptibility to antibiotics, disk diffusion method was used according to Jorgensen and Turnidge [13]. Isolate was grown anaerobically in mTPY broth at 37 oC overnight. Then, a liquid culture (50 µl) was spread onto mTPY agar plate. A total of 12 commonly used antibiotics from various classes were used in this study (μg per disc): ampicillin, 10; erythromycin, 15; chlorampheni-col, 30; bacitracin, 10; rifampin, 5; vancomycin, 30; neomy-cin, 30; streptomycin, 10; kanamycin, 30; gentamicin, 10; nalidixic acid, 30; and tetracycline, 30 (Liofilchem, Italy). Each disc was transferred onto the surface of the agar plates, which were then incubated anaerobically at 37 oC for 72 h. After incubation, diameter of inhibition zones was recorded. Antibiotic susceptibility of the isolate was categorized based on the zone of inhibition. This categorization was carried out by comparing susceptibility patterns of Lactobacillus spp. and Bifidobacterium spp., as the isolate was initially suspected as Bifidobacterium sp.

2.3.3 Antimicrobial activity

           Isolate ability to inhibit growth of pathogenic bacteria was assessed using well diffusion assay [14]. In this study, E. coli and S. aureus from Biotechnology Culture Collection (BTCC) were used. Isolate was cultured anaerobically in TPY broth, while pathogenic bacteria were cultured aerobically in nutrient broth (NB) (Merck, Germany). All tubes were incubated overnight at 37 °C. After incubation, the isolate liquid cultures were centrifuged at 5000× g for 20 min at 4 oC and the resulting cell-free supernatant (CFS) was collected. Liquid cultures of pathogenic bacteria (1%) were mixed with liquefied nutrient agar (NA) (Merck, Germany) in Petri dishes. Upon solidification, wells with a diameter of 6 mm were prepared using sterile pipettes. Then, cell-free supernatant (100 µl) was added into each well and plates were incubated at 37 °C for 24 h. Ampicillin (1 mg/ml) was used as positive control, while TPY broth was used as negative control. After incubation, diameter of inhibition zones was recorded. In well diffusion assay, inhibition zones might be achieved by subtracting diameter of the well from that of the clear area.

2.3.4 Mucosal adhesion ability

           To assess mucosal adhesion ability of the isolate, three steps were carried out. First, porcine mucus was purified using modified method from Garcia-Gonzalez et al. [15]. Small intestine of a pig was opened, rinsed with cold PBS and the mucosal layer on the inner lining of the intestine was gently scraped off using spatula. Collected mucus was transferred into 50 ml of cold PBS. The mucosal suspension was centrifuged twice, first at 11,000× g for 10 min and then at 20380× g for 20 min. Supernatant was collected and filtered using cellulose acetate (CA) membrane syringe filters (0.2 μm). Protein concentration in the filtered solution, considered mucin, was estimated using Biuret method. First, bovine serum albumin (BSA) solution was prepared to match the estimated mucin protein concentration. The BSA was filtered using CA membrane syringe filters (0.2 μm). Second, mucin and BSA were immobilized on microplates based on a modified method from Tallon et al. [16]. Mucin and BSA solutions (100 μl per well) were added to various wells of 96-well microplates. Microplates were incubated overnight at 4 °C, then each well was washed twice with 200 μl of PBS. Third, adhesion assay was carried out using the immobilized mucus and BSA on the microplates. The liquid bacterial culture incubated at 37 °C for 16 h was diluted with PBS and three various dilution factors (100 μl each) were selected (N-initial). Diluted liquid cultures were added to each well coated with mucin or BSA and then microplates were incubated at 37 °C for 1, 2 and 3 h. Microplates were washed twice with sterile PBS (200 μl per well) and 200 μl of 0.05% (v/v) Triton X-100 solution were added to the microplates, followed by incubation at 25 °C with agitation at 50 rpm using shaker incubator to allow desorption of adherent bacteria (N-adhere). After 2 h of incubation, N-initial and N-adhere were spread-plated on MRS agar and incubated anaerobically at 37 °C for 48 h. Bacterial colonies on the agar plates were enumerated and the percentage of adhesion cells was calculated using the Eq. 1:

Eq.1

 % Adhesion = [log (N-adhere) / log (N-initial)] × 100%

2.3.5 Oxidative stress tolerance

           Isolate tolerance to oxidative stress was assessed based on a method from Watanabe et al. [17] with modifications. For this assay, MRS broth without manganese was prepared manually. The composition was as follows: 10 g/l bacteriological peptone, 8 g/l beef extract, 4 g/l yeast extract, 20 g/l D (+) glucose monohydrate, 1 ml of tween 80, 2 g/l diammonium citrate, 5 g of sodium acetate and 0.2 g of magnesium sulfate heptahydrate. MRS broth with manganese was prepared by adding 0.04 g/l manganese (II) sulfate. Isolate was cultured in MRS broth and incubated at 37 °C for 24 h under anaerobic conditions. Then, 1% culture (v/v) was inoculated into two various test tubes, each contained MRS broth with or without manganese. The two test tubes were incubated anaerobically at 37 °C and aliquots of the cultures were sampled upon reaching the exponential and stationary phase. Oxidative stress tolerance was assessed by adding 0.5% (v/v) H2O2 to the cultures. Sampling was carried out within 15–20 min after addition of H2O2. Collected samples were then serially diluted and spread-plated onto MRS agar and then CFUs were counted. The relative abundance (%) [18] included ratio of the cell number after incubation to that before incubation at 100%

  1. Results and Discussion

3.1 Isolation and identification

A pure isolate from the isolation and purification processes was named SU-KC1a. Morphological observation and biochemical activity tests suggested that SU-KC1a was a rod-shaped, Gram positive, catalase negative, non-acid-fast and non-motile bacterium (Figure 1). All these characteristics were similar to those of Bifidobacterium and Lactiplantibacillus species [19].

Isolation and purification processes were carried out anaerobically to achieve anaerobic lactic acid bacteria such as Bifidobacterium spp. However, molecular identification based on 16S rRNA showed that SU-KC1a was a species of L. plantarum. Since taxonomic nomenclature of L. plantarum species was revised to L. plantarum in April 2020, isolate was named L. plantarum SU-KC1a [20].

Assessing the evolutionary distance of L. plantarum SU-KC1a to other Lactiplantibacillus strains and Bifido-bacterium involved constructing a phylogenetic tree using 16S rRNA sequences of L. plantarum SUKC1a, three L. plantarum isolated from HBM, three L. plantarum isolated from various fermented foods and two Bifidobacterium spp. isolated from HBM as an outgroup (Figure 2). Interestingly, lack of clear separations between L. plantarum isolated from HBM and those from various fermented foods suggested that niche alone might not be an assessing factor in the evolution of Lactiplantibacillus spp. This finding challenged assumption that various niches led to distinct evolutionary paths within the Lactiplantibacillus genus. Variability in microbiota within breast milk, affected by factors such as maternal diet and antibiotic use during pregnancy and lactation, indicates a complex interplay of environmental and genetic factors shaping microbial evolution. This suggests separate evolution of multiple Lactiplantibacillus strains within HBM environments.

As many as 590 various genera in breast milk have been detected through 16S rRNA sequencing, ten most frequently detected genera include Staphylococcus, Streptococcus, Lactobacillus, Pseudomonas, Bifidobacterium, Coryne-bacterium, Enterococcus, Acinetobacter, Rothia and Cuti-bacterium [21,22]. Taghizadeh et al. [23] isolated Lactobacillus spp. from breast milk, including L. gasseri, L. rhamnosus, L. acidophilus, L. plantarum, L. reuteri, L. fermentum, L. animalis, L. brevis, L. helveticus, L. oris, L. casei, L. gastricus, L. vaginalis, L. crispatus, and L. salivarius. To further explain relationships between the niche and evolution of Lactiplantibacillus, additional analyses such as whole-genome comparisons and metabolic profile assessments are recommended. These analyses can provide deeper insights into the genetic and functional differences between Lactiplantibacillus strains originating from various niches, shedding light on their adaptive strategies and evolutionary trajectories.

3.2 Effects of oxygen on cell morphology

Lactobacillus spp. are addressed for their ability to grow in anaerobic and microaerophilic conditions [26]. Based on the findings of this study, L. plantarum SU-KC1a was able to grow without oxygen (anaerobic) and with low oxygen concentrations (microaerophilic). Watanabe et al. [17] reported that L. plantarum could capture oxygen in the presence of manganese metal ions and thus provide aerotolerance characteristics. Moreover, MRS media typically contain manganese metal ions in the form of MnSO4 (0.04 g/l) as a source of nutrition. Figure 3 shows morphology of L. plantarum SU-KC1a cells after anaerobic and microaerophilic incubations. Although cells were rod-shaped, anaerobic incubation resulted in shorter rod shape and smaller cell size. According to Parlindungan et al. [27], stress conditions could cause morphological changes in Lactobacillus spp. as an adaptive response of bacteria to survive. For microaerophilic Lactobacillus spp., anaerobic incubation might cause stress for the cells. To improve survival under stress conditions, rod-shaped LAB formed coccoid-like shapes, which were expected to preserve cell membrane and safeguard internal structures from the external environment, ensuring genetic material intact and preserving low rates of metabolic activities [28]. Morphological changes in L. plantarum SU-KC1a under anaerobic and microaerophilic conditions further emphasized adaptive responses of Lactobacillus spp. to various oxygen environments. However, further studies are needed to assess the effects of oxygen concentration on the growth and stress responses of L. plantarum.

3.3 Mupirocin resistance test

In this study, L. plantarum SU-KC1a could grow on mupirocin selective media (mMRS) anaerobically and microaerophilically. Furthermore, L. plantarum F75 showed no growth on mMRS media (data not shown). This finding suggested that L. plantarum SU-KC1a might possess inherent resistance to mupirocin, indicating potential trait variations within strains of similar species. Pechar et al. [29] reported that mupirocin was often added to the media for isolating bifidobacterial cultures because of the intrinsic resistance characteristics of Bifidobacterium spp. However, it is reported that Lactobacillus spp. are susceptible to mupirocin. Similar to Sunardi et al. [18], L. plantarum SU-KC1a demonstrated high-level resistance to mupirocin that might be acquired by several L. plantarum strains. However, mupA gene, causing high-level mupirocin resistance, was not detected in the genome of L. plantarum SU-KC1a. Therefore, the specific gene responsible for the isolate high-level resistance to mupirocin is still unidentified.

3.4 Carbohydrate fermentation test

  1. plantarum SU-KC1a demonstrated ability to ferment glucose, fructose, lactose, FOS, GOS, inulin and maltodextrin, as evidenced by the color changes of the media from purplish brown to yellow-brown. Media without carbon sources, serving as a negative control, showed no color changes overall. This alteration in color within the media indicated shifts in pH (Figure 4). Markowiak-Kopec and Slizewska reported that carbohydrate fermentation by Lactobacillus spp. produced organic acids such as lactic acid, acetic acid and short chain fatty acids (SCFA), leading to decreases in pH in the large intestine [30]. Since pH of the media supplemented with various carbohydrates decreased after incubation, these results indicated that L. plantarum SU-KC1a was capable to ferment FOS, GOS, inulin and maltodextrin. Analysis of various responsible enzymes for carbohydrate fermentation has been carried out (data are published soon).

The highest growth of L. plantarum SU-KC1a was observed in media supplemented with GOS, followed by FOS, inulin and maltodextrin. Ability of bacteria to ferment carbon sources can be affected by the degree of polymerization (DP). GOS, as a prebiotic, includes a DP range of 2–7, making it easier to ferment by bacteria. FOS, inulin and maltodextrin include DPs of > 10, 2–60 and 3–11, respectively. Higher DP values might prolong the fermentation duration of FOS, inulin and maltodextrin, compared to GOS fermentation. Bacterial ability to ferment oligosaccharides with a DP > 10 includes half of the speed; at which, oligosaccharides ferment with a DP < 10 [31]. Cao et al. [32] reported that three oligosaccharides (GOS, FOS and MOS/mannooligosaccharides) were able to enhance growth of L. plantarum. In this study, bacterial growth rate was slower when cultured on oligosaccharides rather than glucose. Mandadzhieva et al. [33] reported that most of Lactobacillus strains could ferment mono, di and trisaccharides; however, each strain demonstrated a unique fermentation pattern for various carbohydrate sources. Generally, carbohydrates with lower DP are easier to utilize.

3.5 Tolerance to various pH levels and concentrations of bile salts

To qualify as a probiotic candidate, resistance of cells to various pH levels and bile salt concentrations is critical for their survival in the digestive tract and during the processing of functional foods. Sunardi et al. [18] reported that L. plantarum F75 and L. plantarum SU-KC1a were susceptible to simulated gastric fluid (pH 2) but able to tolerate the fluid after 30 and 60 min of exposure. After 120 min of exposure, L. plantarum SU-KC1a was still detected but at low numbers [18]. Compared to Sunardi et al. [18] who used simulated gastric fluid with pepsin supplementation, this study used MRS broth adjusted to various pH levels. Figure 5A demonstrates that L. plantarum SU-KC1a could preserve its high survival after 3 h of exposure to pH 2. Similar to Huang et al. [34], several L. plantarum strains demonstrated minimal or no decreases in cell viability even after 6 h of exposure to low pH and digestive enzymes (pepsin and trypsin).

A previous study by de Melo Pereira et al. [35] included that bile salt resistance within a concentration range of 0.3–2% was a prerequisite for surviving passage through the human digestive tract. As depicted in Figure 5B, number of L. plantarum SU-KC1a cells decreased with increasing bile salt concentration; however, cells demonstrated robust survival within all concentrations of bile salts. Another study by Sunardi et al. [18] reported that L. plantarum F75 and SU-KC1a were able to survive exposure to 0.3% of bile salts for 3 h. This phenotype was attributed to the capacity of various L. plantarum strains to produce bile acid hydrolases, which catalyzed conversion of conjugated bile salts into free bile salts [36].

3.6 Antibiotic susceptibility       

Table 1 shows that L. plantarum SU-KC1a demonstrated resistance to three antibiotics, including vancomycin, streptomycin and nalidixic acid from various classes. These findings were partially similar to those of Sunardi et al. [18] who reported that L. plantarum SU-KC1a was resistant to antibiotics such as vancomycin and nalidixic acid. Antibiotic susceptibility tests in the two studies were carried out using different media: mTPY agar in this study and Mueller-Hinton agar in Sunardi et al. [18]. It is noteworthy that resistance profile of L. plantarum SU-KC1a was not unique, as antibiotic resistances in Lactobacillus spp. to β-lactam, glycopeptides, tetracycline, lincosamides and quinolones (nalidixic acid) have previously been documented. According to Mancino et al. [37], L. plantarum was typically resistant to aminoglycosides (gentamycin, neomycin, streptomycin and kanamycin), bacitracin, quinolone (nalidixic acid) and vancomycin. One of these resistances is intrinsic resistance to Lactobacillus spp., meaning that this resistance type cannot be transferred to other bacteria, suggesting that L. plantarum SU-KC1a may be safe for use as a probiotic. If resistance genes are located on plasmids, there is a risk of horizontal gene transfer to other bacteria [38].

3.7 Antimicrobial activity                              

Since the beginning of this century, numerous serious bacterial infections have evolved resistance to commonly prescribed antibiotics, creating major healthcare issues worldwide. Hence, there are urgent needs to investigate novel natural sources for antibacterial compounds. Antimicrobial activity of L. plantarum SU-KC1a against E. coli and S. aureus was assessed based on the inhibition zone.Based on the diameter of inhibition zones (Figure 6), L. plantarum SU-KC1a demonstrated greater inhibitions to E. coli (5.0 ± 0.7 mm), compared to S. aureus (2.0 ± 0.7 mm). Malanovic and Lohner [41] reported that antimicrobial activity of Lactiplantibacillus spp. was more visible in Gram-negative bacteria than Gram-positive bacteria. Gram-negative bacteria include outer membranes that are selective for antimicrobials. In this study, concentration of antimicrobial compounds in the cell-free supernatant (CFS) could not be assessed, potentially leading to various results. Further investigations regarding antimicrobial activity can be carried out using broth dilution and time-kill assays [42].

Lactiplantibacillus spp. possess numerous mechanisms for eliminating pathogenic bacteria, including production of inhibitory components such as bacteriocins and lactic acid. Bacteriocins produced by L. plantarum, commonly known as plantaricins, encompass various peptide structures and are generally classified into two main classes. Currently, various types of plantaricin have been identified, including plantaricins A, C, D, E, F, J, K, S, T, Y, 423, 163, 149, 35D, BN, SA6, LC74, KW30, ZJ008, LD1, UG1, NC8, C11 and NA [43]. Plantaricin EF, targets the bacterial membrane, leading to the leakage of intracellular compounds and eventual cell death [44].

They detected that exponential-phase cultures were more susceptible to H2O2, compared to that stationary-phase cultures were. According to Sousa-Lopes et al. [51], cell membrane permeability to H2O2 increased in exponential phase, compared to stationary phase.

  1. Conclusion

In conclusion, L. plantarum SU-KC1a, originally isolated from HBM in Indonesia, demonstrated significant characteristics as a promising candidate for probiotic uses. This strain demonstrated robust oxidative stress tolerance and antibiotic resistance, particularly to mupirocin, as well as showing ability to thrive with various prebiotic supplementations. Its strong tolerance to acidic conditions and bile salts as well as its significant antimicrobial characteristics and adhesive capabilities to mucin underscore the microbial suitability for diverse environments. These attributes not only highlight its relevance in local contexts, but also suggest its potential as a valuable candidate for probiotics development on a global scale, offering possible benefits for human health and well-being. Further studies are essential to fully realize the microbial therapeutic and commercial potentials.

  1. Acknowledgements

This study was supported by the Center for Research and Community Development, Universitas Pelita Harapan (grant no. P-078-S/FAST/III/2020 and P-010-S/FaST/V/2021). The authors thank Basic (203) and Advanced (407) Biology Laboratory, Department of Biology, UPH, for providing the necessary facilities.

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

Conceptualization, T.T.J; methodology, M.S. and H.V.; data collection, Y.C., A.F.R, J.O., E.T.P., A.C.J.; writing—original draft preparation, M.S.; writing—review and editing, J.J. and T.T.J. All authors have read and approved final version of the manuscript.

Fungal Pretreatment Strategy to Enhance Growth of Pediococcus acidilactici via Solid-state Fermentation of Spent Malt Grain

Mitra Shokouhi, Zohreh Hamidi-Esfahani, Mohammad Amir Karimi-Torshizi

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e32
https://doi.org/10.22037/afb.v11i1.46281

Background and Objective: Growing probiotic bacteria on agricultural wastes via solid-state fermentation presents challenges, compared to fungal fermentation. Spent malt grain, a byproduct of non-alcoholic malt beverage production, is rich in proteins, fibers, minerals and bioactive compounds, making it a promising substrate for solid-state fermentation. However, the lignocellulosic structure of spent malt grain limits nutrient accessibility for probiotics. Fungal pretreatment with Aspergillus oryzae can degrade these complex fibers, enhancing nutrient availability and fermentation potential of the spent malt grain. This study aimed to select probiotic bacteria with superior characteristics, assess fungal pretreatment effects on viability as well as changes in spent malt grain composition during solid-state fermentation.

Material and Methods: Four probiotic strains were assessed for antimicrobial, antitoxic and antioxidant characteristics, as well as acid and bile resistance. Pediococcus acidilactici was selected as the optimal strain. Solid-state fermentation was carried out using spent malt grain with fungal pretreatment to enhance Pediococcus acidilactici growth.

Results and Conclusion: Probiotic viability increased from 9.4 to 9.76 log CFU.g⁻¹, protein content increased by 32.45% and ash by 59.6%, while neutral and acid detergent fibers decreased by 21.6 and 9.1%, respectively. These results demonstrated effectiveness of fungal pretreatment combined with solid-state fermentation, providing a sustainable method for enhancing probiotic growth on spent malt grain with potential uses in ruminant and poultry feeds.

Conflict of interest: All authors declare no conflict of interest.

  1. Introduction

 

Solid-state fermentation (SSF) is an effective method for enhancing the nutritional value of agricultural and industrial wastes. It decreases biological wastes, prevents its accumulation in the environment and generates beneficial and nutritious compounds in primary substrates, allowing for reuse in the food cycle [1]. Brewers’ spent grain (BSG), a major byproduct of the beer industry, is rich in fibers, minerals, proteins and other valuable chemical compounds [2]. In the present study, spent malt grain (SMG), which contains similar compounds to BSG, was used and sourced from a non-alcoholic malt beverage production facility. The SSF has been interested due to its ability to grow micro-organisms on waste substrates under limited or non-free water conditions. This process can enhance the substrate by decreasing fiber and increasing protein and amino acid contents, making it appropriate as food or feed supplements for humans and animals. Solid-state fermentation of BSG using probiotic microorganisms includes the potential to produce products with beneficial effects on consumers [3].

Probiotics are defined as “live microorganisms that provide health benefits to the host once consumed in sufficient quantities” [4]. Use of probiotics not only plays a role in human health, but also enhances natural digestion and maintains health of animals. In addition, it is effective in preventing activity of pathogens, metabolism of nutrients, removal of toxic substances and energy balance [5]. Beneficial effects of probiotic microorganisms on the substrate are connected to their ability to tolerate conditions of the stomach and intestines in humans and animals, which completely depends on the type of microorganisms and their resistance to acid and bile. Probiotics such as Lactobacillus strains include proteins resistant to acid shock. Numerous microorganisms are susceptible to destruction by bile salts due to the presence of lipids and fatty acids in their cell membranes. However, many lactic acid bacteria (LABs) are resistant to bile [6, 7].

Fermentation of agricultural wastes using probiotic bacteria enhances antioxidant and antimicrobial activities of the fermented products and protects gut microbiota against oxidative stress [8]. Fermentation of cereal wastes with P. acidilactici inhibits growth of Aspergillus, Penicillium and Fusarium Sps. by producing antimicrobial compounds; thereby, preventing mycotoxin production. The resulting fermented products, rich in probiotic bacteria, can be used in human foods and animal feeds [9]. The complex lingo-cellulosic structure of agricultural wastes poses challenges for their use as substrates by microorganisms, especially bacteria. Therefore, various pretreatment methods are used to modify them. These methods, including physical, chemical, physicochemical, ionic liquid and biological approaches, have been studied for enhancing nutrient availability in BSG. Each method includes strengths and limitations. Physical pretreatments need high energy but may not fully degrade lignocellulose. Chemical methods improve nutrient accessibility but create inhibitory byprod-ucts that need neutralization. Ionic liquids offer effective breakdown but are expensive and challenging to recover. Physicochemical treatments are efficient but costly. Optimizing BSG physicochemical pretreatment processes can decrease energy consumption. This enhances efficiency of nutrient release and substrate degradation. Biological pretreatments with white and soft-rot fungi are environ-mental friendly and produce nutrient-rich substrates; how-ever, they are time-intensive. [10,11]. This method modifies lignocellulosic structure of the substrate by partially or completely removing lignin; thereby, enhancing microbial access to cellulosic parts of the raw materials. The primary focus includes breaking down lignin and hemi-cellulose; then, allowing it to digest cellulose effectively [12]. Use of fungi in fermentation process increases nutritional quality of the animal feeds prepared from BSG [13].

Carrying out and optimizing a pretreatment facilitate probiotic growth; by which, cellulosic and hemicellulosic structures of BSG are broken down. For example, A. oryzae is an appropriate option for the fungal pretreatment of BSG because of its lignocellulosic, proteolytic and amylolytic enzymes [14]. Treatment with A. oryzae results in produc-tion of fermentable sugars and increases in the substrate protein contents. When A. oryzae spores are directly used in BSG treatment, they can serve as a nutrient source in a probiotic propagation media [15]. In previous studies, SSF of BSG has majorly been carried out using fungi and a bacterial strain of Bacillus Sp. for purposes, including production of value-added fermented products, enzymes, lactic acid and proteins [13,16,17]. However, use of probiotic bacteria to enhance the nutritional value of this substrate has not been investigated. From the four probiotic bacterial strains assessed in the study (based on their resist-ance to acid and bile and antimicrobial, antitoxic and anti-oxidant activities), the best one was selected for investiga-ting growth on SMG and fungal pretreatment.

In this study, SSF of SMG was investigated for the first time using probiotic P. acidilactici and fungal pretreatment of A. oryzae PTCC 5163. Effects of this pretreatment on the growth and viability of the selected probiotic bacterium and modification of the chemical composition were investigated as well.

  1. Materials and Methods

2.1 Materials

Most chemicals and brain-heart infusion soft agar (BHI), Rogosa Sharpe broth (MRS broth), Rogosa, Sharpe agar (MRS agar), nutrient agar (NA) and nutrient broth (NB) were purchased from Merck, Darmstadt, Germany. Potato dextrose agar (PDA agar), ProMedia, bile salts and DPPH were purchased from Merck and Sigma-Aldrich, Darmstadt, Germany. Rice containing aflatoxin was provided by Department of Poultry Sciences, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran. The P. acidi-lactici is a commercial strain isolated from Bactocell© probiotic (Lallemand Animal Nutrition, France), L. plantarum MT. ZH393, L. fermentum MT. ZH893, lactobacilli isolated from Mazandaran cheese (isolated in Department of Food Science and Technology, Tarbiat Modares University), Escherichia coli Nissle 1917 isolated from Mutaflor prob-iotic, A. oryzae PTCC 5163, Salmonella serovar enteritidis RTCC 1621, Salmonella enterica serovar typhimurium RTCC 1679, Salmonella serovar infantis ATCC 51741, E. coli O1:K1, E. coli O2:K2 and E. coli O78:K80 (strain χ1378) were provided by the microbial collection of the faculty of veterinary medicine, university of Tehran, Tehran, Iran. The SMG was provided by Behnoosh, an alcohol-free beer manufacturer, Tehran, Iran.

2.2 Methods

2.2.1 Probiotic strains

Four probiotic strains were used in this study, including P. acidilactici, L. plantarum MT. ZH393, L. fermentum MT. ZH893 and E. coli Nissle 1917.

 

 

 

2.2.2 Preparation of microbial cultures

To activate the probiotic strains, except E. coli Nissle 1917, a small quantity of the lyophilized microbial powder was poured into 10 ml of sterile MRS broth. Mixture was incubated at 37 ˚С for 24 h under anaerobic conditions. Nutrient broth was used for the growth of E. coli Nissle 1917. Overnight cultures of probiotic strains were centrifug-ed at 6000× g for 10 min at 4 °C (Model 3-30KS, Sigma, Germany). Cells separated from the culture media were washed twice with sterile Ringer's solution and then suspended in Ringer's solution. Suspensions were prepared to 0.5 McFarland standard (≃1.5×108 CFU.ml-1) and inocul-ated to the substrate at an inoculum culture volume of 20% of the total substrate (v.w-1). Methods of preparing microbial suspension were similar for all the experiments of the study needing microbial suspension. Pathogenic indicator bacteria were activated in Mueller-Hinton broth for 24-48 h at 37 °C. To prepare stock culture of A. oryzae PTCC 5163 spores, the microorganism was cultivated on the surface of PDA. Spores were formed and collected after 10-12 d of incubation at 25 °C. Spores were passed through cotton filters to separate mycelia and then diluted with a phosphate buffer saline (PBS) solution (pH 7). The number of spores was adjusted to 1.6×107 spores.ml-1 using a hemacytometer slide (MarienFeld, Germany). Then, sterile glycerol 10-13% )vol.) was added to the mixture. This was divided into small vials and stored at -20 °C until use.

2.2.3 Antimicrobial activity

Agar spot test was used to assess the ability of strains to inhibit the growth of pathogenic microbes (Salmonella serovar enteritidis RTCC 1621, Salmonella serovar typhim-urium RTCC 1679, Salmonella serovar infantis ATCC 51741, E. coli O1:K1, E. coli O2:K2 and E. coli O78:K80 (strain χ1378). Two microliters of a 24-h culture of L. plantarum MT. ZH393, L. fermentum MT ZH893, and P. acidilactici were spotted on the surface of MRS agar and E. coli Nissle 1917 strain was spotted on nutrient agar. All plates were incubated anaerobically at 37 °C for 24 h. Then, 10 ml of BHI soft agar (0.7%) were mixed with 100 µl of the activated pathogenic microorganisms and spread on the surface of MRS agar. Media were incubated at 37 °C for 24 h [18]. Presence of a clear zone or halo less than 1 mm was classified as +, while a halo of 2–5 mm was categorized as ++, a halo greater than 5 mm or complete inhibition of growth was categorized as +++ and absence of any halo formation was categorized as –.

2.2.4 Resistance to acidic conditions

Briefly, L. plantarum MT, ZH393, L. fermentum MT. ZH893 and P. acidilactici in MRS broth and E. coli Nissle 1917 in nutrient broth were incubated at 37 °C for 48 h. After assessing population of the microorganisms, 1 ml of each medium was inoculated into 9 ml of PBS (pH 7.4) with pH adjusted to 2.5 using HCl. After 2 h of incubation at 37 °C, number of the micro-organisms was re-enumerated. Results were compared to assess effects of acidic environ-ment on decreasing population of probiotic strains [18, 19].

2.2.5 Bile resistance

Bile resistance of the microorganisms was assessed using a method by Sharifi Yazdi et al; in which, 100 µl of the microbial suspension (prepared as described in Section 2.2.2) were added to the culture media with bile salts (Model B8756, Sigma-Aldrich, Germany) and without bile salts, respectively. Then, light absorption of the samples was measured using a spectrophotometer (Model Cary 60 UV-Vis, Agilent Technologies, USA) at 600–650 nm before and after 8 h of incubation [20]. The inhibition coefficient (Cinh) was calculated using the Eq. 1.

Cinh = (T8 - T0) control - (T8 - T0) treatment) / (T8 - T0) control                                                                                                                                                                                                                                                                           Eq. 1

Where, T0 and T8 included reading at 0 and 8 h, respectively.

2.2.6 Antioxidant activity

One milliliter of each microbial suspension was added to 1 ml of a newly prepared DPPH solution (2,2-diphenyl-1-picrylhydrazyl). Then, mixture was agitated strenuously and set for 30 min at ambient temperature in dark. After re-centrifugation (8000× g, 10 min, 4 °C), decreases in absorb-ance were measured at 517 nm [8,21]. The scavenging activity was calculated using Eq. 2.

Scavenging activity (%) = 1 - (Asample - Ablank /Acontrol) × 100                                                                                                                                                                                                                                                 Eq. 2

Where, sample included cells, DPPH, and methanol, blank included cells and methanol, and control included Ringer’s solution and DPPH.

2.2.7 Antitoxic characteristics

In this study, the toxin included aflatoxin. The best food method was used to extract aflatoxins from contaminated rice based on the AOAC official method [22]. Generally, 1 g of the toxin-containing sample was mixed with 20 ml of 55% (vol.) aqueous methanol and agitated for 30 min. Then, 10 ml of hexane were added to the mixture and agitated for 15 min. Then, mixture was centrifuged at 2000× g for 5 min and the supernatant was discarded. Then, 20 ml of chloroform were added to the mixture and agitated gently for 15 min. The lower phase was filtered using filter paper coated with anhydrous sodium sulfate (1 g in the bottom of the funnel) and the toxin dissolved in chloroform was concentrated by evaporation of chloroform. The extracted toxin was dissolved in 5 ml of 55% (vol.) aqueous methanol and added drop by drop to 20 ml of phosphate buffer solution saline (pH 7) until the absorbance of 360 nm reached nearly 0.1 (initial absorption). A microbial suspension was prepared from each strain overnight culture with a concentration of 8 McFarland (2.4 × 109 CFU.ml-1). Then, 1 ml of the microbial suspension was poured into a 2-ml microtube and centrifuged at 10000× g for 10 min (Heraeus Biofuge Pico, Thermo Fisher Scientific, USA). Supernatant of the microbial pellets was discarded and the pellets were washed twice with PBS solution (pH 7). One milliliter of the prepared toxin was added to the pellets in the bottom of the microtubes. Toxin and pellets were incubated for 4-5 min and thoroughly mixed. They were incubated for 1 h, absorbance was read at 360 nm and the absorption decrease percentage was calculated through Eq. 3.

                                                     Eq. 3

2.2.8 Spent malt grain preparation

Wet SMG from a malt beverage factory was dried at 50 °C for 24 h using the oven (Model NST-F300-51605, Noor Sanat Ferdows, Iran). After reaching a constant weight and grinding, this was passed through a 1-mm sieve and stored at 4 °C for further use.

2.2.9 Preparation of spent malt grains for solid-state fermentation

Briefly, 10 g of SMG was poured into a 250-ml Erlen-meyer flask. The moisture was adjusted to 70% based on dry matter and pH was adjusted to 5.4 using calcium carbonate solution (2.5% w.v-1), which was an appropriate pH for the growth of A. oryzae PTCC 5163. Then, this was sterilized at 121 °C for 15 min using autoclave (Model 121 A, Iran Tolid, Iran).

2.2.10 Fungal pretreatment

Briefly, 2 ml of A. oryzae PTCC 5163 spores (1.6 × 107 spores.ml-1) were inoculated into sterile SMG, mixed well and incubated at 30 °C for 24 h. Sterile calcium carbonate solution (2.5% w.v-1) was used to adjust the pH to 6.15–6.2. It is noteworthy that all steps were carried out under completely sterile conditions. Then, 2 ml of a P. acidilactici suspension (prepared as described in the Preparation of Microbial Cultures section) adjusted to 0.5 McFarland were inoculated into the sample; in which, A. oryzae PTCC 5163 was grown for 24 h. Flasks were sealed with parafilm and incubated at 37 °C for 24 h. To assess effects of fungal pretreatment, a series of experiments were carried out that involved inoculating the probiotic bacteria without prior fungal treatments.

2.2.11 Composition analysis of spent malt grains

Crude protein content was assessed using Kjeldahl method and the nitrogen content was multiplied by 6.25. Moreover, Soxhlet extraction was used to assess the lipid content (Model PSU-500S, Pecofood, Iran). To assess the ash content, samples were burned in electric furnaces at 650 °C for 4 h (Model SIC 37, Ecotec, Iran). Moreover, the moisture content was estimated using weight differences at 105 °C for 3.5 h using oven (PAAT ARIA, Iran). All the assays were carried out according to AOAC [23]. Acid detergent fiber (ADF), neutral detergent fiber (NDF) and acid detergent lignin (ADL) were assessed using sodium sulfite and necessary solutions, based on the Van Soest method [24]. Hemicellulose was investigated from the differences between NDF and ADF and cellulose was investigated from the differences between ADF and ADL [17].

2.2.12 Statistical analysis of data

To assess significant differences between the means, one-way analysis of variance was carried out using Duncan's multiple range test. All experiments were carried out in triplicate, with a significance level set at p < 0.05. Additionally, figures were created using Excel 2016 software (Microsoft, USA).

  1. Results and Discussion

3.1 Antimicrobial activity

Among the probiotic strains, P. acidilactici completely prevented growth of the pathogenic strains. Moreover, L. fermentum MT. ZH893 and L. plantarum MT. ZH393 included good antimicrobial characteristics, compared to E. coli Nissle 1917 which included a weaker antimicrobial activity than other strains (Table 1, Figure 1). Metabolites such as bacteriocins produced by P. acidilactici might inhibit other LAB strains. Moreover, lactic and acetic acids from the fermentation process led to decreases in pH below 4.5; thus, preventing growth of pathogenic bacteria [9]. In a study by Tavakoli et al. strains of L. plantarum and L. fermentum showed desirable antimicrobial activities due to their metabolites e.g. organic acids, bacteriocins, and hydrogen peroxide [18]. In another study, it was indicated that metabolites of P. acidilactici such as bacteriocins demonstrated antimicrobial activities against three indicator bacteria of L. monocytogenes, E. coli and S. aureus [25].

3.2 Resistance to acidic conditions

From the four strains, only E. coli Nissle 1917 showed significantly lower resistance to acidic conditions, compared to those the other strains did. The other probiotic strains demonstrated excellent acid resistance with no significant differences. Survival rates in acidic conditions for L. fermentum MT. ZH893 and P. acidilactici were assessed as 96 and 95.7%, respectively (Figure 2). Regarding resistance to acidic conditions, findings of this study were similar to those of a study; in which, P. acidilactici showed appropriate resistance to stomach acid conditions. This was possibly because of its ability to decrease activity of the H+-ATPase enzyme, which regulated internal and external pH and led to the resistance of microorganisms to acidic conditions [26]. In a study by Tavakoli et al., Lactobacillus strains showed resistance to acidic conditions and survival of the strains in acidic conditions varied 68.8–94.9% [18]. Several theories are available on the resistance of Gram-positive bacteria such as LAB to acidic conditions, including stability of their mRNA as well as systems responsible for modifying composition of the cell membrane, extruding protons, protecting macromolecules, changing metabolic pathways and producing alkali. Furthermore, proton pumps heavily rely on the F1F0-ATPase to maintain internal pH [27].

3.3 Bile resistance

Results of the present study demonstrated that all strains included good resistance to bile salts, however, inhibitory coefficient of P. acidilactici was the lowest, thus its resistance to bile was the highest (Figure 3). Resistance to bile in the probiotic strains might be explained by its special bilayer structure that could tolerate unfavorable alkaline conditions [26]. Probiotic strains resistant to bile salts can survive in the digestive system, form colonies and subsequently provide health benefits for humans and animals. Probiotic survival against bile balances the gut microorganisms and enhances overall health and performance [28]. Similarly, another report revealed that six probiotic isolates, belonging to P. acidilactici, included good bile resistance [20].

3.4 Antioxidant activity

Results indicated that P. acidilactici and L. fermentum MT. ZH893 included the highest scavenging rates (nearly 65%), compared to L. plantarum MT. ZH393 with the lowest rate (49%) (Figure 4).  Regarding good antioxidant activity of the probiotic strains especially P. acidilactici, membrane-bound enzymes might be responsible for the antioxidant activity. One of these enzymes is dipeptidyl peptidase-III (DPP-III), which decreases oxidative stress and its associated diseases [29]. Li et al. reported that the highest quantity of scavenging activity for L. plantarum strains, isolated from Chinese fermented food, was roughly 50%; similar to the findings of the present study. Based on their study, proteins or polysaccharides on the cell surface contributed to the antioxidant activity of this strain since removing these compounds decreased capacity to remove DPPH free radicals [21]. In another study, a wild L. plantarum strain isolated from fermented cabbages significantly improved scavenging activities of superoxide anion, DPPH and hydroxyl radicals. Naturally, these radicals contribute to lipid oxidation, as they are precursors of singlet oxygen and hydroxyl radicals [30].

3.5 Antitoxic characteristics

Results of the present study demonstrated that all probiotics could bind to aflatoxins, although two strains of P. acidilactici and, L. fermentum MT. ZH893 showed greater absorption rates. Moreover, no significant difference was seen at 5% level with L. plantarum MT. ZH393 (Figure 5).

Studies have shown strain-dependent relationships between toxin binding and LAB. Furthermore, it was demonstrated that polysaccharides and peptidoglycans of the bacterial cell walls possibly contributed to aflatoxin binding [31]. Since probiotic bacteria attach to aflatoxins through physical adhesion rather than covalent bonding, non-viable bacterial cells can bind to them as well. In other words, probiotic microorganisms (bacteria and fungi) and their enzymatic metabolites detoxify aflatoxin molecules by cleaving their difuran rings [32]. Similarly, it is reported that L. plantarum isolated from a type of fermented cheeses demonstrated a strong ability to bind to aflatoxin B1 when the microorganism was alive and after it was killed by heat [33].

3.6 Fungal pretreatment

After selecting P. acidilactici based on its superior probiotic characteristics, effects of fungal pretreatment with A. oryzae PTCC 5163 on its growth and survival were studied. Results of the present study indicated that fungal pretreatment at various pH levels included significant differences in the number of probiotics, compared to the control condition (without fungal pretreatment). Adjusted pH values were assessed based on the pH range appropriate for the growth of fungi and bacteria. At all pH values, pretreatment by A. oryzae PTCC 5163 significantly increased the number of P. acidilactici after 48 h of fermentation (from 9.4 to 9.76 log CFU. G-1) (Figure 6). The BSG is full of lignocellulosic materials that can be destroyed by filamentous fungi, whose hyphae can easily penetrate the inter-particle space. Therefore, using fungi for pretreatment is an appropriate alternative to chemical and physical methods because in addition to be cost-effectiveness, they can easily be used in SSF [13].

The P. acidilactici can convert cereal byproducts into products that can be used in human and animal foods [9]. Enhancing the microbial growth and survival yields further favorable outcomes in the substrate. Pretreatment of lignocellulosic materials enhances accessibility of the substrate for probiotic bacteria because of the hydrolysis of hemicellulose, cellulose and lignin. Fungal pretreatment by Aspergillus strains with amylolytic and cellulolytic enzymes is an environmental friendly method that increases access of probiotic bacteria to materials needed for their growth [34, 35]. A study showed that use of A. oryzae and S. cerevisiae could produce bioethanol from BSG. Technically, A. oryzae breaks down cellulose and hemicellulose, creating sugars for ethanol production by S. cerevisiae. This pretreatment provides necessary enzymes without excessive sugar breakdown or high levels of furan-based inhibitors [36].

3.7 Assessing spent malt grain compounds

Fermentation of SMG with P. acidilactici following fungal pretreatment with A. oryzae PTCC 5163 led to significant increases in protein contents with 32.4% increases (Table 2). Increases in protein during fermentation could include various causes. One possible reason included the accumulation of fungal and bacterial biomasses in SMG substrate after fermentation [17]. These results were similar to results reported by Bekatorou et al., who reported 20–36% increases in the protein contents of BSG, when treated by Aspergillus strains [15]. In the fermentation of brewer's dried grains and spent sorghum using microorganisms, more than 30% increases in protein contents were reported [38]. The lipid contents of SMG did not change significantly after fermentation (Table 2). This finding was similar to those of other studies, where fermentation with LAB did not lead to significant changes in lipid contents [8].

A significant result of the fermentation process included decrease in fiber contents. The NDF and ADF decreased by 17.7 and 8.3%, respectively. Additionally, cellulose and hemicellulose contents decreased by 27.35 and 8.5%, respectively (Table 2). This decrease in fiber contents could be attributed to activity of the microorganisms and their metabolites, breaking down complex carbohydrates such as cellulose and hemicellulose. These findings are supported by previous studies; in which, fermentation with LAB and their metabolites such as organic acids and bacteriocins led to decreases in fiber contents. Similarly, SSF of BSG with fungi have been shown to decrease fiber and cellulose contents [37]. Fermentation process resulted in a significant increase of 59.6% in ash contents (Table 2). Increase in ash contents might reflect accumulation of minerals and other inorganic components in fermented SMG or was likely due to metabolic activity of the microorganisms and their metabolites during fermentation [17]. Similar studies reported significant increases in ash contents following fermentation of agricultural wastes and BSG by bacteria and fungi [38].

  1. Conclusion

The study reported that P. acidilactici included superior antimicrobial characteristics and bile resistance, compared to those the L. plantarum MT. ZH393, L. fermentum MT. ZH893 and E.coli Nissle 1917 did. Its antitoxic and anti-acidic characteristics did not show significant differences at 5% level. The SSF resulted in lower bacterial growth than that fungi did, but pretreatment with fungi significantly boosted development of the probiotic bacterial strain. Combination of fungal pretreatment and SSF led to changes in the culture media composition, including decreases in fibers (17.7%) and increases in proteins (32.4%) and ashes (59.6%). Decreasing fibers enhances the product's bioavailability; thereby, improving access to other essential nutrients. Significant increases in protein contents transform the products into potential protein sources. Moreover, increased ash contents signified higher mineral concen-trations within the fermented products. This study innovatively used solid-state fermentation of SMG with P. acidilactici, using A. oryzae fungal pretreatment to enhance bacterial growth, marking a novel approach in producing high-value fermented products. The fermented product includes the potential for use in livestock and poultry feeds or as a dietary supplement in associated industries.

  1. Acknowledgements

The financial support from the Research Council of Tarbiat Modares University (IG-39804) is gratefully acknowledged. The authors express their deepest gratitude to the Faculty of Technical and Natural Resources of Tuyserkan College, Bu-Ali Sina University, for providing facilities for some experiments.

  1. Conflict of Interest

All authors declare no conflict of interest.

  1. Authors Contributions

“Conceptualization, Hamidi-Esfahani Z; methodology, Hamidi-Esfahani Z and Karimi-Torshizi MA; validation, Hamidi-Esfahani Z, Shokouhi M and Karimi-Torshizi MA; investigation, Shokouhi M; writing-original draft preparation, Shokouhi M; writing-review and editing, Hamidi-Esfahani Z; supervision, Hamidi-Esfahani Z and Karimi-Torshizi MA”

Assessment of milk-based high protein products as ingredients of low-fat ice creams

Ayan Orazov , Sirvan Abbasbeigi, Zhansaya Koishiyeva, Liudmila Nadtochii

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page 34
https://doi.org/10.22037/afb.v11i1.46380

Background and Objective: This study assessed the potential of incorporating high-protein dairy ingredients into ice cream recipes in response to increasing consumer interest in high-protein foods with improved nutritional benefits. The goal was to assess the functional and compositional characteristics of protein ingredients derived from skim milk, which could play a critical role in creating low-fat ice cream that meets sensory expectations.

Material and Methods: Various milk-based protein ingredients, including milk protein concentrate, rennet casein, acid casein, sodium caseinate, calcium caseinate, and micellar casein concentrate, have been analyzed for their protein content, ash content, amino acid profiles, and functional characteristics such as water-binding and viscosity-building capacities. This comprehensive assessment was conducted to assess their potential to replicate the creamy texture of traditional ice creams.

Results and Conclusion: The protein content of the ingredients varied from 82.5–92.7%, with acid casein and sodium caseinate showing the highest levels. This high protein content contributed to excellent water-binding and viscosity-building characteristics, which are critical for replicating the creamy texture of ice creams. Rennet casein and sodium caseinate included higher ash contents, which could affect the ice creams' mineral content and overall flavor profile. Although milk protein concentrate, sodium caseinate, and micellar casein concentrate lacked certain essential amino acids, they included biological values of over 50%, thereby enhancing the nutritional quality of low-fat ice cream formulations. The potential of these high-protein dairy ingredients to significantly affect the development of healthier ice cream products with desirable sensory and physicochemical characteristics cannot be exaggerated. Incorporating these ingredients into low-fat ice cream offers a promising approach to creating further nutritious products.

Conflict of interest: The authors declare no conflict of interest.

1. Introduction

Ice cream is one of the most famous frozen desserts used in most countries. According to the FDA (2014), ice cream should contain more than 10% milk fat or 10% non-fat milk solids [1]. If fat content limitations are modified in recipes, high-protein dairy-based ingredients can be used instead of milk fat. Modern technologies in the dairy industry, including microfiltration (MF), ultrafiltration (UF), nanofiltration (NF), and ion exchange (IE), have made it possible to achieve a wide range of high-protein ingredients with specific functional and technological characteristics that can optimize composition and technological aspects of food production [2,3].

In addition to the functionality of dairy-based ingredients for food uses (water binding and viscosity building; emulsification; flavor enhancement; gelling and heat setting; whipping, foaming, aeration, and so on), milk proteins include excellent nutritional value [4]. Due to their distinctive physiological characteristics, high protein ingredients are vital compounds of functional and specialized foods for various age groups, ranging from infant formulations to elderly nutrition [5,6]. Research worldwide verifies the benefits of high-protein diets in weight management, glycemic index regulation, bone health maintenance, muscle loss prevention, and sarcopenia risk [7‒9].

Moreover, modern trends in healthy eating guide consumers to consume foods with high protein content. In 2020, foods with high protein content accounted for nearly 50% of the consumer market [10]. Increased consumer demand for high-protein foods derives innovation in industrial production, addressing the diversity of dairy ingredients and knowledge of their functional characteristics and nutritional values [11].

Expansion of the range of products with increased protein contents is associated with the priority criteria for consumers to choose food products, including attractive organoleptic characteristics, low-calorie contents, health benefits, and safety. Thus, ice creams with decreased fat due to increased protein content should include specified organoleptic characteristics and high biological values [12, 13]. This study collected data on high-protein dairy-based ingredients and technological aspects of their production, as well as functional and technological characteristics that could affect quality indicators of low-fat ice creams. It also compared their nutritional values, focusing on amino acid composition.

2. Materials and Methods

2.1 Materials

Although skim milk is a secondary resource, it is rich in nutrients, particularly protein, allowing it to produce a wide range of high-protein ingredients with increased nutritional values. Samples of high-protein ingredients were made by foreign manufacturers (Lithuania and Australia) and supplied by Unifood, St. Petersburg, Russia [14]. Chemical compounds (Table 1 and Figure 1) and functional-technological characteristics (Table 2) of high-protein dairy-based ingredients were:

- Milk protein concentrate (MPC)

- Casein such as rennet casein (RC) and acid casein (AC)

- Caseinates such as sodium caseinate (SC) and calcium caseinate (CC)

- Micellar casein concentrate (MCC)

2.2          Methods

2.2.1 Protein and amino acid analyses [15]

The energy values of high-protein ingredients were calculated using coefficients of the energy values of nutrients, such as 3.8 kcal.g-1 for proteins and carbohydrates and 8.9 kcal.g-1 for fats.

The National Standard of the Russian Federation (NSRF) 55577-2013 was used to assess the energy values of the high-protein ingredients based on skim milk. This standard is entitled “specialized and functional food products. Information on distinctive features and efficiency” [16]. According to NSRF 55577-2013, a high-protein product must provide at least 20% of the energy value from proteins. To calculate the amino acid score, the content of each essential amino acid of the investigated ingredient was compared with its content in the reference protein (FAO WHO, 2011) by Eq. 1:

Where, Аx was the mass fraction of an essential amino acid of the investigated ingredient, g.100g-1 protein, and A was the mass fraction of an essential amino acid in the reference protein, g.100g-1 protein.

An amino acid with a scoring rate of less than 100% was called “limiting.” In the presence of several limiting amino acids in the composition of the product/ingredient, the amino acid with the lowest amino acid score was called the “first limiting amino acid.” The biological value of the protein component was assessed using Eqs. 2–4 suggested by Professors I. A. Rogov and N. N. Lipatov, which included coefficients of differences of the amino-acid score (CDAAS, %) and biological value (BC, %). In particular, CDAAS (%) showed the average excess of the amino acid score of essential amino acids, compared to the lowest score of an essential amino acid.

Where, ∆DAAS was the difference between the amino-acid score calculated based on Eq. 3 and n was the number of essential amino acids.   Where, Ci was the score of “i” th essential amino acid (%), and Cmin was the minimum score of essential amino acids (%). The protein component's biological value (BV) was assessed using Eq. 4.                  

3. Results and Discussion

3.1 High-protein Composition and Energy Value

Analysis of high-protein ingredients derived from skim milk, following NSRF 55577-2013 standards, verifying that all the samples were qualified as high-protein products, contributing more than 20% of their total energy value from protein (Table 3 and Figure 2). Sodium caseinate (SC) varied, offering the highest energy value at 360.4 kcal.100g-1, closely followed by acid casein (AC) at 359.6 kcal.100g-1. Protein contributes over 95% of the total caloric content in most samples, underscoring its significance (Figure 2) [4]. These characteristics make these ingredients excellent candidates for high-protein formulations, particularly in low-fat ice creams, where nutritional value is critical without compromising sensory appeal. SC and AC emerge as the top performers when breaking down the protein content, with protein concentrations reaching 92.7% and 92.0%, respectively. Although lactose and fat contents were minimal, they varied within the samples. For example, SC included the lowest lactose content (0.3%), while RC (rennet casein) included the highest fat content (up to 2.0%) [17]. These differences were more than nutritional details alone, as they affected the functional roles of the ingredients in food products.

3.2 Protein and Amino Acid Composition

In addition to total protein content, the amino acid composition of these high-protein ingredients is critical to their nutritional quality. Compared to FAO/WHO 2011 standards, a rich profile of essential amino acids (EAA) is seen (Table 4 and Figure 3). For example, micellar casein (MCC) and milk protein concentrate (MPC) delivered high levels of leucine (9.8 g.100g-1 protein for MCC) and lysine (7.90 g.100g-1 protein for MCC), which are vital for muscle growth and repair [18]. However, RC was limited by its lower lysine content, which decreased its overall biological value (BV) compared to other ingredients (Figure 3). The biological value of these protein ingredients varied significantly. The MCC, MPC, and SC were particularly advantageous, as they lacked limiting amino acids, resulting in biological values of 58.19, 72.23, and 75.35%, respectively. These characteristics make them highly appropriate for enriching the protein content of low-fat ice creams, which aims to enhance nutritional value without losing quality (Table 5) [19,20].

3.3 Biochemical Pathways and Production Processes

The high-protein ingredients analyzed were produced through various biochemical and biotechnological processes such as coagulation, ultrafiltration, and dehydration (Figure 4). These methods included distinct products with specific functional characteristics. For example, caseinates produced through enzymatic or acid coagulation include excellent emulsifying and gelling characteristics, making them ideal for improving the texture and mouthfeel of ice creams [21]. The SC and AC, known for their high protein content, include unique water-binding and viscosity-enhancing capabilities. These characteristics are key for replicating the creamy texture of full-fat ice creams in low-fat versions, ensuring that the final product still appeals to consumers despite decreased fat content [22,23].

3.4 Physicochemical and Sensory Effects

The type and concentration of high-protein ingredients profoundly affect the physicochemical characteristics of low-fat ice creams. Proteins, especially SC and MCC, play critical roles in binding water and creating emulsions, which are essential for maintaining the desired texture and stability. These ingredients help control ice crystal growth during freezing and storage and contribute to smoother, further homogenous products (Table 1) [24,25]. From a sensory perspective, these proteins' ability to prevent fat globules from coalescing enhances the overall appearance and mouthfeel of the ice cream. For example, MPC provides a balanced combination of protein and fat that smooths the texture without introducing off-flavors that can occur with proteins high in ash content, such as RC and SC [26‒28]. Furthermore, the gelling capability of SC contributes to a firmer structure, which is critical for product stability over time [29].

3.5 Functional and Technological Benefits

Functional characteristics of high-protein ingredients are more significant than simple nutritional improvements as they are essential for maintaining the quality of low-fat ice creams during processing and storage. Characteristics such as solubility, dispersibility, and heat stability at neutral pH are critical for ensuring product integrity [30]. For example, excellent solubility of these proteins prevents sedimentation and helps maintain uniformity of the final product. Additionally, their emulsifying characteristics ensure that fat is evenly distributed, preventing separation and enhancing texture [31]. These protein water-binding and viscosity-enhancing capabilities allow for significant fat decrease without losing the creamy smooth textures that consumers expect. This is particularly important as demand increases for lower-calorie options that do not compromise taste [32]. Furthermore, the ability of these ingredients to contribute to browning and color development during cooking enhances the visual appeal of ice creams, making them further attractive to consumers [33,34].

3.6 Challenges and Limitations

Despite the advantages of using high-protein dairy ingredients in low-fat ice creams, challenges are still reported. One significant issue includes the potential for off-flavors, particularly with higher ash-content ingredients such as RC and SC. These off-flavors can negatively affect the overall taste profile of the ice creams, making it essential to carefully select and combine ingredients to achieve the desired flavor [35]. Additionally, ingredients such as RC with higher moisture content can affect the ice cream texture and decrease its shelf life, needing formulation adjustments [36].

3.7 Future Directions

The results of this study highlight several opportunities for further studies. One opportunity includes the synergistic effects of combining various protein types to optimize low-fat ice cream's sensory and physicochemical characteristics. Investigating how protein modifications such as enzymatic treatments or cross-linking that further improve functionality can lead to further versatile uses of these ingredients [37,38]. Addressing off-flavors and moisture content challenges is a priority for improving product quality. Innovations in biotechnology, including advanced ultrafiltration techniques and enzymatic modifications, offer promising ways to develop better high-protein ingredients that meet nutritional and sensory expectations [39,40]. Further studies in this field will likely lead to additional innovative solutions that align with consumer preferences for healthier, more enjoyable food options [41].

4. Conclusion

In conclusion, incorporating high-protein dairy-based ingredients into low-fat ice cream formulations offers a promising approach to creating healthier dessert options that retain desirable sensory and physicochemical characteristics. These ingredients can be designed to enhance texture, stability, and overall quality using modern biotechnological processes such as ultrafiltration and enzymatic treatments. Comparative analysis of various high-protein ingredients highlights their unique contributions, with sodium caseinate and micellar casein highlighting their exceptional water-binding, gelling, and emulsification characteristics. While challenges such as managing off-flavors and moisture content are still addressed, developments of high-protein dairy ingredients provide significant opportunities for innovations in the food industry. Future studies should focus on optimizing protein blends and investigating new processing techniques to further enhance the appeal and functionality of low-fat ice creams. Integrating biochemistry and biotechnology in food science drives advancements that align with consumer demands for nutritious, delicious, and sustainable food products.

5. Acknowledgements

This study was funded by the Science Committee of the Ministry of Education and Science, Republic of Kazakhstan (grant no. AP19175509).

6. Conflict of Interest

The authors declare no conflict of interest.

Short Communication


Effects of Pasteurization on Antihyperglycemic and Chemical Parameter of Xoconostle (Stenocereus stellatus) Juice

Jose Alberto Mendoza-Espinoza, Sindu Irais Gomez-Covarrubias, Edgar Sierra Palacios, Erika Alvarez-Ramirez, Rayn Clarenc Aarland, Fernado Rivera-Cabrera, Rocio Gomez-Cansino, Patricia Bustamante-Camilo, Fernando Diaz de Leon-Sanchez

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e4
https://doi.org/10.22037/afb.v11i1.43252

Background and Objective: The antihyperglycemic effect is associated with the pre-hispanic fruit xoconostle or tunillo (Stenocereus stellatus, Pfeiffer and Riccobono). This fruit includes in various varieties, distinguished by color. Xoconostle fruits are highly perishable. Therefore, the aim of this study was to assess antihyperglycemic effects of xoconostle juice before (fresh) and after pasteurization. The study focused on the white and red varieties of xoconostle.

Material and Methods: In this study, the method involved collecting juice from xoconostle fruits, followed by pasteurization. Chemical, physical and microbial parameters were assessed for the juice and the ability to decrease capillary glucose levels (antihyperglycemic effect) was assessed in male Wistar rats.

Results and Conclusion: Pasteurization process led to decreases in total phenolic content of the red variety of xoconostle fruit, while the white variety showed increases in malic acid content. Despite these changes, fresh and pasteurized juices of the two varieties showed lower blood glucose levels, compared to the control group. Red variety demonstrated a stronger antihyperglycemic effect. In conclusion, pasteurization did not affect pharmacological effects of xoconostle juice, making it a viable preservation method without compromising the antihyperglycemic charac-teristics. Results of this research suggest a conservation method which preserve the antihyperglycemic effects while extending its shelf life.

Conflict of interest: The authors declare no conflict of interest.

Leptospirosis in Slaughterhouse Personnel: A Seroepidemiologic Study Using Microscopic Agglutination Test

Ali Hokmi, Seyyed Saeed Eshraghi, Abbas Rahimi Foroushani, Gholamreza Abdollahpour, Ramin Mazaheri Nezhad Fard

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e5
https://doi.org/10.22037/afb.v11i1.43527

Background and Objective: Meat can be contaminated by Leptospira species. This bacterial pathogen causes severe leptospirosis disease in humans and animals. The major aims of this study were to assess seroepidemiological prevalence of leptospirosis in employees of a slaughterhouse in Guilan Province, Iran, using microscopic agglutination test and further investigate the positive samples using nested polymerase chain reaction method.

Material and Methods: In this study, 150 employees of a slaughterhouse in Guilan Province, Iran, were participated after completing written consents and personal questionnaires. This sample size was calculated based on the mean prevalence of the pathogen in the region. After assessing sera of the participants for Leptospira antibody using microscopic agglutination test, urine samples were collected from the positive participant for further assessments using nested polymerase chain reaction.

Results and Conclusion: Based on the results, microscopic agglutination test was positive for 10.7% of the participants. However, Nested-PCR was negative for the positive microscopic agglutination tests on sera collected from the participants with antibodies against Leptospira antigens. The current results demonstrate that Leptospira can occur in asymptomatic humans in slaughterhouses and highlight the high potential of the disease transmission to humans in the province. Therefore, further extended control and prevention measures for slaughterhouse workers are recommended to guarantee the food safety.

Conflict of interest: The authors declare no conflict of interest.

Black Grass Jelly Encapsulated Lactobacillus plantarum Mar8 in Honey and D-Allulose Beverage Enriched with Mangosteen Pericarp Extract

Titin Yulinery, Novik Nurhidayat, Nilam Fadmaulidha Wulandari, Sri widawati, Suliasih Suliasih, Lusianawati widjaja

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e8
https://doi.org/10.22037/afb.v11i1.43264

Abstract

Background and Objective:

Black grass jelly served in sweet syrup is one of the Chinese and East and Southeast Asian traditional beverages. An innovative enrichment can make it a better functional food. This study innovatively enriched the black-jelly food with formulas of probiotic Lactobacillus plantarum Mar8, honey, D-allulose and mangosteen pericarp extract. The probiotic viability, antioxidant and hypoglycemic potential were investigated as well.

Material and Methods: Ready-to-drink functional beverages included mangosteen pericarp extract varied in concentrations of 0.1, 0.2 and 0.4 mg ml-1, D-allulose in honey and encapsulated probiotic Lactobacillus plantarum Mar8 in black grass jelly containing konjac and carrageenan. The probiotic viability, antioxidant activity and hypoglycemic potential were the selective parameters for the functional beverage formulas. The viability of probiotic Lactobacillus plantarum Mar8 was assessed using total plate count method. Antioxidant activity was assessed based on the reaction of 2,2-Diphenyl-1-picrylhydrazyl radical scavenging. Hypoglycemic potential was investigated by counting petite yeast cells after treating with black grass jelly formulas. Significant differences were reported using one-way analysis of variance and Duncan's test. Statistically significance included p-values≤0.05.

Results and Conclusion: The probiotic Lactobacillus plantarum Mar8 encapsulated in black grass jelly survived well in the honey, D-allulose and mangosteen pericarp extract formulated beverages. Honey supported the probiotic viability better, producing further antioxidants and high potentials in hypoglycemia than that those of other formulas did. Mangosteen pericarp extract enriched the functionality of the black grass jelly probiotic beverages. However, further studies are needed to assess favorability and stability of this functional food.

Conflict of interest: The authors declare no conflict of interest.

Food Storage, Processing and Genetic Stability Studies of Bacillus (Heyndrickxia) coagulans BCP92 (MTCC 25460)

Sohel S Shaikh, Chinmayi Joshi, Farhana Malek, Anis Malik, Manoj Gandhi

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e22
https://doi.org/10.22037/afb.v11i1.44919

Background and Objective: Bacillus coagulans are spore-forming probiotics that provide health benefits when consumed in adequate amounts. Therefore, they can be added to functional foods to enhance their nutritional values. The aim of the present study was to investigate stability of Bacillus coagulans BCP92 in various functional foods during food processing and storage conditions as well as genetic stability study of the strain using DNA fingerprinting method.

Material and Methods: Bacillus coagulans BCP92 was incorporated into a range of functional foods and beverages such as instant coffee, tea, sweet corn soups, oatmeal, upma, gummies, brownies, ice creams, non-alcoholic beverages, chocolates, peanut butter and shrikhand. Viability of the bacteria was assessed using pour plate method under various processing and storage conditions. Genetic stability of B. coagulans was assessed using DNA fingerprinting.

Results and Conclusion: The viability was shown in food processing conditions of teas (99.97%), coffees (99.45%), sweet corn soups (99.36%), oatmeal (98.81%), upma (99.57%), gummies (99.67%) and brownies (98.14%). In food-storage conditions, relative viability was as follows: fruit juices (98.91%), lassi (98.72%), energy drinks (98.70%), cold coffees (99.29%), milk chocolates (99.87%), white chocolates (100.13%), dark chocolates (99.20%), shrikhand (99.04%), ice creams (99.45%), and peanut butters (98.32%). Furthermore, DNA fingerprinting showed genetic stability of the probiotic B. coagulans BCP92. In conclusion, B. coagulans BCP92 has shown good viability in various food processing and storage conditions. Moreover, it is genetically stable, thus making it a good candidate for addition to functional foods.

  1. Introduction

 

The potential health benefits of probiotics, which involve improving gut microflora, have been a topic of scientific interests for many years. However, it has only recently begun to receive scientific assessments [1]. Probiotics are living microorganisms that confer health benefits to the host when consumed in sufficient quantities [2]. Several studies have revealed that consumption of probiotics decreases risks of antibiotic-associated diarrhoea [3], symptoms of irritable bowel syndrome (IBS) [4], risks of lactose intolerance [5] and constipation [6] and risks of carcinogens and helps in decreases of obesity and enhancement of immune responses and decreases of cholesterol levels [7]. To confer the specific health benefits of incorporated probiotics in food products, the recommended adequate levels of probiotics (106–107 CFU.ml-1) should be provided in the final products [8]. Preserving viability of the probiotic cultures in foods until the end of shelf life is an important criterion for providing effective probiotic food products [9]. It has been observed that the viability of most probiotic bacteria is lost during processing and storage conditions. Furthermore, only a limited number of bacteria can survive harsh conditions of the gastrointestinal tract (GIT) [10]. An effective way to deliver probiotic bacteria includes incorporation of them into food products, making it easier for the consumers to maintain their gut health, considering that many people choose probiotic food products instead of probiotic capsules and pills [11].

Awareness of the importance of maintaining gut health has led to great increases in demands for probiotic foods. Probiotics are either used as starter cultures in combination with traditional starters or alone and incorporated into dairy products, where many functional characterisations are improved by the addition of probiotics. However, there are several challenges linked to function and stability of the probiotics in dairy products [12]. It is generally accepted that probiotic products should include a minimum concentration of 106–107 CFU.g-1 or CFU.ml-1 and a total concentration should be 108–109 CFU.g-1 consumed daily to exert the probiotic effects [13,14]. Numerous probiotic foods include dairy products such as ice creams, fermented milks, frozen desserts, yoghurts, cheeses, milk powders and cheesecakes, [12,15,16], as well as non-dairy products such as oat drinks, commercial fruit juices, soya milks [17–19]. However, spore-based Bacillus-based probiotics have shown higher survival rates than those others have. In a study by Hashemi et al. [20], it was observed that survival rates of the samples with B. coagulans were higher than those with Lactobacillus acidophilus. Similarly, Soares et al. detected that the Bacillus strains, which included probiotic characteristics, showed a greater viability than that the probiotic strains of Bifidobacterium and Lactobacillus did [21]. Stability of probiotics is always a concern during the storage and processing conditions. The present study focused on the stability assessment of Bacillus coagulans BCP92 under various food processing and storage conditions to assess its potential as a probiotic addictive for enhancing the nutritional values of food products. Furthermore, assessment of genetic stability of the strain was carried out using DNA fingerprinting method.

  1. Materials and Methods

2.1 Microbial culture

Bacterial spores of Bacillus coagulans BCP92 (MTCC 25460) used in this study were produced at Pellucid Lifesciences, India. Concentration of the prepared B. coagulans spores was 150 billion CFU.g-1 (11.146 log CFU.g-1). Standard pour plate technique was used to assess the total viable bacterial count. The B. coagulans spores were thoroughly mixed in the food product and incubated at 75 °C for 30 min using water bath, followed by rapid cooling down to below 45 °C. Suspension was serially diluted in sterile peptone water. An appropriate quantity of diluents was poured into a sterile petri plate and mixed with molten glucose yeast extract BC agar (Hi media M2102, India) in triplicate. Plates were incubated at 40 °C for 48–72 h. The mean of these viable counts was expressed as log10 CFU.g-1. All the Chemicals and reagents were purchased from Merck, Germany, and the microbiological media were purchased from Hi Media, India.

2.2 Assessment of the stability of Bacillus coagulans BCP92 under food processing conditions

The B. coagulans BCP92 was added to a variety of food products and beverages such as instant coffees, teas, sweet corn soup powders, oatmeal, upma, cornflakes, gummies and brownies to assess its stability under certain processing conditions. The B. coagulans BCP92 stability under food processing conditions was studied by comparing the initial count with that after the processing conditions.

2.2.1 Instant coffees and teas

Instant coffee (7.5 g) and tea (1.9 g) powders were mixed with 14 mg each of B. coagulans powder. The prepared mixtures were dissolved in 100 ml of hot water (80–85 °C). Samples from tea and coffee were collected at 0 and 30 min and viable counts of B. coagulans BCP92 were analysed using standard pour plate method.

2.2.2 Sweet-corn soup powders and oatmeal

Briefly, B. coagulans BCP92 (14 mg) was mixed uniformly with sweet-corn soup powder (10 g.serving-1) and oatmeal (100 g.serving-1) separately. Mixture was cooked in 150 ml hot water (80–85 °C).  Cooked samples were collected at 0 and 30 min to analyse the viable cell count of B. coagulans BCP92 using pour plate method.

2.2.3 Upma and cornflakes

Ready-to-eat breakfast upma and cornflakes were purchased from a local market. Upma (50 g·serving-1) was added into warm water (80–85 °C) and cooked for 2 min. Then, 14 mg of B. coagulans BCP92 were added to the mixture, stirred well and cooked for 2 min. Pour plate method was used to assess viable count of B. coagulans BCP92 in samples of 0 and 30 min. One serve of 100-g cornflakes was mixed with 150 ml of hot milk and cooked for 5 min. Then, 14 mg B. coagulans BCP92 were added to the mixture and set for 5 min. Samples were collected at 0 min and 30 min to assess the viable count of B. coagulans BCP92 using pour plate method.

2.2.4 Gummies

All the requirements for gummies such as sugar, flavour, sodium citrate, citric acid, corn syrup, water and pectin were mixed for a batch of gummies for 1 kg material to investigate the bacterial survival under processing conditions. All the ingredients of gummies were mixed and heated to dissolve all the contents. Once all the ingredients dissolved, they were mixed with B. coagulans BCP92 (14 mg.3 g-1) at not greater than 85–90 °C in the final mixture before it solidifies. Viable count of B. coagulans BCP92 was measured in gummies and the molten sample once mixed using pour plate method.

2.2.5 Brownies

All the necessary ingredients for preparing brownies such as flour, salt, cocoa powder, eggs, brown sugar, vanilla essence, vegetable oil and butter were mixed thoroughly to prepare the batter, then B. coagulans BCP92 (14 mg.30 g·serving-1) was added to the batter and baked at 175 °C for 22–25 min. Viable count of B. coagulans BCP92 was calculated in the brownies before and after baking using pour plate method.

2.3 Storage stability of Bacillus coagulans BCP92 in various food matrices

Stability of B. coagulans BCP92 was assessed under standard food storage conditions for ice creams (-20 °C), peanut butters (22–25 °C), non-alcoholic beverages, chocolates and shrikhand (4 °C) based on the ICH Guideline Q1A(R2) [22].

2.3.1 Ice creams

A batch of ice cream was homogenously mixed with B. coagulans BCP92 (14 mg.100 ml serving-1) and 100 ml of ice cream were dispensed in a sterile ice cream cup. The ice cream was stored at -20 °C for 6 m. The primary bacterial count of the B. coagulans BCP92 was carried out immediately after mixing of B. coagulans BCP92. Samples were collected monthly for enumeration up to 6 m of storage. Pour-plate technique in triplicates was used to carry out the bacterial count.

2.3.2 Non-alcoholic beverages

Four various types of commercial beverages of fruit juices, energy drinks, lassi and cold coffees were purchased from a local market. The B. coagulans BCP92 (14 mg.serving-1) was inoculated into four sterile flasks containing fruit juices (100 ml), energy drinks (250 ml), cold coffees (200 ml) and lassi (180 ml). All flasks were sealed and stored at 4 °C. Viability of B. coagulans BCP92 in all beverages was assessed using pour plate method. Stored samples were collected for analysis on Days 0, 30, 60, 90, 120 and 180. All analyses were carried out with three replicates.

2.3.3 Chocolates

Three types of chocolates were purchased from a local market, including white, dark and milk chocolates. Chocolate bars were melted by heating at 45–50 °C. Then, B. coagulans BCP92 (14 mg.100 ml serving-1) powder was thoroughly mixed with the molten chocolates. The mixture of chocolate and probiotics was stored at 4 °C. Viability of B. coagulans BCP92 in chocolates was assessed using pour plate method. Stored samples were collected for analysis on Days 0, 30, 60, 90, 120 and 180. All analyses were carried out with three replicates. 

2.3.4 Peanut butter

Peanut butter was purchased from the local market. Samples (32 g·serving-1) were inoculated with B. coagulans BCP92 (14 mg·serving-1). Peanut butter and probiotic powder were mixed uniformly and stored at room temperature (RT). Then, B. coagulans BCP92 viability was assessed after 0, 30, 60, 90, 120 and 180 days of storage.

2.3.5 Shrikhand

Shrikhand was purchased from a local market, added into probiotic B. coagulans BCP92 (14 mg.100 g.serving-1) and stored at 4 °C. Stored samples were collected for analysis on Days 0, 30, 60, 90, 120 and 180. All analyses were carried out with three replicates. 

2.4 Genetic stability of Bacillus coagulans BCP92

For the comparisons from two various stages of the production process, primary cultures in the form of VIAL and final product batch samples were used. Generally, DNA was isolated from each sample. Quality of the DNA was assessed on 1.0% agarose gel and a single band of high-molecular weight DNA was observed. Moreover, DNA fingerprinting of the cultures was carried out using rep-PCR method and MSP-PCR fingerprinting. Two types of rep-PCR fingerprinting were applied [23] using BOX (50-CTACGGCAAGGCGACGCTGACG-30) and (GTG)5 primers (5-GTGGTGGTGGTGGTG-3) [24]. Briefly, 20 ul of PCR amplicons were separated on 2% agarose gel and banding patterns were analyzed using Gel-analyzer software. The dendrogram was plotted using unweighted pair-group method and arithmetic averages with correlation levels expressed as proportions of the Pearson correlation coefficient.

2.5 Statistical analysis

Viable count of B. coagulans BCP92 was expressed as log10 CFU.serving-1 in food processing conditions and log10 CFU g-1.ml-1 in food storage conditions. All analyses were carried out with three replicates. Results included averages of the three independent determinations. Differences between the two values were calculated using student’s t-test. Level of the significance for all statistical tests was p < 0.05.

  1. Results and Discussion

3.1 Stability of Bacillus coagulans BCP92 in food processing conditions 

Stability of B. coagulans BCP92 was studied by measuring viability of the bacteria in various food matrices under certain processing conditions (Figure 1). The primary viable count of B. coagulans BCP92 in tea was 9.31 ±0.02 log10 CFU serving-1 and in coffee was 9.38 ±0.02 log10 CFU serving-1. After 30 min, these values were 9.30 ±0.05 and 9.33 ±0.02 log10 CFU serving-1, respectively. The B. coagulans preserved 99.97% of its viability in tea. In instant coffee, viability of B. coagulans after processing was preserved up to 99.45%. Viability of B. coagulans BCP92 was assessed in sweet corn soup and oatmeal during processing. The B. coagulans was incorporated into corn soup powder and oatmeal by adding hot water. In soup preparation, the primary B. coagulans of 9.38 ±0.03 log10 CFU serving-1 preserved a 99.36% viable count after 30 min. The oatmeal primary concentration was 9.25 ±0.03 log10 CFU serving-1 and after 30 min, it preserved 98.81% viability (Figure 1).

Upma primary concentration was 9.20 ±0.05 log10 CFU serving-1 and after 30 min, it preserved 99.57% viability. The viability studies on cornflakes showed a primary count of 9.22 ±0.02 log10 CFU.serving-1, and after 30 min, it preserved 99.78% of viability (Figure 1). Viability was studied in gummies as well. For gummies before and after processing, they showed 99.67% of relative viability per gummy. The viable count of B. coagulans BCP92 spores in gummy processing conditions showed slight non-significant  decreases in count (Figure 1). Viability studies in brownies showed that the primary concentration of probiotics in each brownie was 9.22 log10 CFU serving-1. After heating, this showed a 98.14% relative survival rate (Figure 1). Studies have shown use of probiotics in functional foods. Polo et al. [25] reported use of B. coagulans in herbal teas. Majeed et al. [26] reported viability of B. coagulans up to 2 y of shelf life when stored with tea and coffee powders. Kahraman et al. [27] and Miranda et al. [28] studied B. coagulans stability in gummies and showed B. coagulans survivals during production and processing. Majeed et al. [29] reported stability of B. coagulans in various food matrices such as hot fudge toppings, chocolate fudges (97.23%) and peanut butters (99.6%) with viability over 95% as well as its viability in apple juices (99.3%) of baked products. Almada et al. [30] showed that eight strains of Bacillus in various baking, cooking and drying processes affected γ of the Bacillus strains; of which, B. coagulans reported higher resistance. Foods containing spore probiotics are becoming popular due to their resistance to heat processes, low water activity, acidic pH and heat stability [31]. In this study, B. coagulans BCP92 showed high viability in various foods during food processing conditions, with viabilities ranging 98.14–99.97% in food products such as teas, coffees, sweet corn soups, oatmeal, upma, gummies and brownies.

3.2 Storage stability of Bacillus coagulans BCP92 in various food storage conditions

Incorporation of B. coagulans BCP92 into a food product was studied to assess viability and stability of B. coagulans BCP92 during storage and its possible use as a food ingredient (Table 1). The relative viability of B. coagulans in ice creams was 99.41%, The primary viable count of B. coagulans in ice creams was 7.32 ±0.04 log10 CFU ml-1 and the final count was 7.28 ±0.06 log10 CFU ml-1 over 6 m of storage (Table 1). Studies show use of ice creams as vehicles for probiotics. Due to exposure of the cells to various stress factors associated with formulation, overrun, melting and storage, losses in viability occur [9]. Fruit juices, energy drinks and cold coffees showed primary counts of 7.34 ±0.01, 6.92 ±0.01 and 7.00 ±0.03 log10 CFU ml-1, respectively. After storage up to 6 m, the preserved viability rates were up to 98.87, 98.74 and 99.23%, respectively (Table 1). Viability of B. coagulans was assessed in various types of chocolates. Results revealed that B. coagulans BCP92 preserved its high viability throughout the entire 180-d storage time. Viability of B. coagulans in milk, white and dark chocolates were 99.99, 100 and 99.16%, respectively (Table 1)

Stability studies in shrikhand and lassi showed consistency of B. coagulans BCP92 as the primary concentration of B. coagulans was 7.32 ±0.08 and 7.03 ±0.02 log10 CFU ml-1 and after the study, it preserved its 99.08 and 98.80% relative viabilities, respectively (Table 1). Stability studies in peanut butters demonstrated a good viability of 98.40% from primary 7.76 ±0.02 log10 CFU ml-1 per serving after 6 m of storage (Table 1).

Various studies report stability of non-spore-forming probiotics, showing survival of probiotics during storage [32,33]. However, probiotic Bacillus strain showed a higher survival rate [20, 21] than Lactobacillus and Bifidobacterium during storage under GIT conditions when studied in cheeses, pasteurized orange juices and breads [21]. A study with L. acidophilus and B. coagulans in ice creams stored at -18 °C for 90 d showed a higher survival rate in  B. coagulans than L. acidophilus [20]. Marcial-Coba et al. [33] microencapsulated Akkermansia muciniphila and L. casei in dark chocolates. In another study, Cielecka-Piontek et al. [34] demonstrated stability of B. animalis subsp. Lactis, Saccharomyces boulardii and B. coagulans GBI-30, 6086 in chocolates. Similar results were reported by Silva et al. [35] in L. acidophilus LA3 and B. animalis subsp. lactis BLC1, showing the highest viabilities of approximately 7.7 and 7.3 log CFU.g-1 in semisweet chocolates, respectively. Lavrentev et al. [36] showed use of B. coagulans as a starter culture and its viability for 60 d and reported satisfactory results for stability and quality characteristics of the product. Maity et al. reported the B. coagulans stability in various food matrices under processing conditions, including lemon iced teas (99.46%), green teas (98.48%), masala teas (98.96%), lemon teas (99.59%), instant coffees (99.79%), upma (99.89%), corn soups (99.79%) and noodles (99.68%) [37]. The B. coagulans BCP92 preserved its stability over 6 m in foods such as fruit juices, lassi, energy drinks, cold coffees, chocolates, shrikhand, ice creams and peanut butters with relative viabilities ranging 98.32–100.13%. In the present study, non-significant decreases were observed in all the food matrices under food processing and storage conditions, showing the versatile nature of B. coagulans BCP92.

3.3 Genetic stability

Samples of “VIAL” (primary sample) and “final product” were provided for the study. Generally, DNA was extracted and DNA fingerprinting was carried out using BOX primers sets, followed by PCR analysis and dendrogram plotting. Genotype of each strain could be differentiated by the distribution of PCR bands and the two samples were closely linked to each other based on DNA fingerprinting patterns in the experiments (Figures 2 and 3). Genomic safety and probiotics attributes showed that B. coagulans BCP92 was safe [38]. Genomic fingerprinting also showed genetic stability of B. coagulans BCP92 in the production cycle; in which, it showed the genetic stability in primary and final samples of production. Majeed et al. reported genetic stability of three various sample batches [24]. Genetic stability studies using DNA fingerprinting verified stability of B. coagulans BCP92.

  1. Conclusion

The present study reported stability of B. coagulans BCP92 in various food matrices under processing and storage conditions. The B. coagulans BCP92 tolerated the low pH of juices, low-temperature storage and heating during food processing conditions. These findings focused on the potential of these food products as carrier vehicles for the delivery and stability of spore-forming probiotics. The B. coagulans BCP92 was also genetically stable in the production process, which was a positive indication of genetic stability of culture. Hence, this finding suggests use of spore-forming probiotic B. coagulans BCP92 in functional foods for gut health improvement and gastrointestinal disorders. Further studies can be carried out on incorporating B. coagulans BCP92 in food products and assessing them on human subjects to gauge their effects on human health. Additional studies on food supplemented with B. coagulans BCP92 can help deeper understanding of its potential benefits for human health and sensory profiling, ultimately leading to advancements in the field of nutrition and wellness.

  1. Conflict of Interest

The authors report no conflict of interest.

Background and Objective: Various products on the market contain probiotics such as lactic acid bacteria, which are promoted with a wide range of benefits. Functionality of these products is linked to the specific strains, bacterial species and viable cell counts. This study aimed to assess conformity of targeted lactic acid bacterial species and viable cell counts in commercially available probiotic products with their labeling, ensuring efficacy of the products.

Material and Methods: Multiplex polymerase chain reaction technique was developed using specific primers to effectively differentiate lactic acid bacteria in probiotic products. Therefore, strains used in the products were targeted and relevant nucleotide sequence data were searched to select two sets of polymerase chain reaction primer pairs of L. pla-F/R and L. para-F/R, targeting 16S ribosomal RNA genes, and L .pen-F/R, targeting recA genes.

Results and Conclusion: The individual primer sets produced the expected target products that matched the labeling for the tested strains of Lactobacillus plantarum, Lactobacillus paracasei and Lactobacillus pentosus. Then, specificity assessing was carried out using multiplex primer sets for single strains, pairwise combinations and triple combinations of lactic acid bacteria. After verifying specificity for all the three strains under similar polymerase chain reaction conditions, sensitivity of the multiplex polymerase chain reaction was investigated by assessing various dilutions of the three lactic acid bacterial strains and commercially available probiotic products. These findings demonstrated potential uses of multiplex polymerase chain reaction in lactic acid bacterial detection techniques. In conclusion, specific primer sets can be used in multiplex polymerase chain reaction to rapidly and effectively detect lactic acid bacterial strains in commercial products.

Conflict of interest: The authors declare no conflict of interest.

Lactic acid bacteria (LAB) are addressed for their beneficial effects on the human gastrointestinal tract, enhan-cing overall immune health. There are recent interests in development of functional LAB products. Demands for the probiotic functional foods are rapidly increasing due to the increased consumer awareness of food effects on health [1]. Researchers have assessed potential uses of probiotics in dairy and nondairy products and their viabilities during storage [2]. They have concluded that the final product should contain a minimum of 106-107 viable cells per serving to benefit consumer health [2]. Their studies have shown that mislabeling of probiotic species is common in commercial products [3]. Lack of appropriate identification of the strains and false efficacy claims have led to confusion. Probiotic products available in the market often use mixed strains. Thus, there are needs to monitor conformities of the labeled bacterial species and viable cell counts.

Polymerase chain reaction (PCR) technique has success-fully been used to detect and differentiate viruses and bacteria in various foods [4]. Rapid and reliable nature of PCR provides a valuable tool for distinguishing closely related species within two groups of lactobacilli [5]. This technique has been used to rapidly identify Lactobacillus plantarum in kimchi [6]. Oligonucleotide primers have been developed from sequences between the 16S and 23S rRNA genes, enabling identification of various lactobacilli strains in dairy products and probiotics using PCR [7]. Further-more, strain-specific PCR can be used for the rapid identi-fication of lactobacilli isolated from food samples [8] and specific identification of ten common lactobacilli and bifi-dobacteria strains in fermented milks [9].

In this study, multiplex PCR method was developed to investigate applicability of molecular detection techniques for LAB using three sets of specific primers sourced from the literature. Moreover, 16S rRNA gene sequences were targeted to explore molecular LAB detection. By amplifying 16S rRNA and recA gene sequences through PCR, this study simultaneously detected three LAB strains as well as mixed LAB strains in the products. Sensitivity of detection was assessed to establish a simple, reliable rapid method appropriate for the effective identification of LAB strains in probiotic products.

  1. Materials and Methods

2.1 Bacterial strains and culture conditions

The LAB strains were stored in a -80 °C freezer. Before the experiments, strains were activated twice using lactobacilli MRS broth (Difco, Detroit, MI, USA) supplemented with 0.05% (w/w) L-cysteine (Merck, Taipei, Taiwan). Strains were cultured under optimal growth conditions at 37 °C for 24 h. Reference strains were provided by the Bioresources Collection and Research Center (BCRC, Hsin-Chu, Tai-wan). The L. pentosus BCRC 17972 and 17973, L. plantar-um F7-1 and L. paracasei BCRC 12193, 12188, 12248 and 17002 were used in this study. Seven strains were used in the current study as well. The commercial probiotic product was purchased from Li-Fong, Tainan, Taiwan, for PCR detection. Each sachet of the bacterial powder contained a high level of viable probiotic cells with 5.0 × 1010 CFU.g-1. Specific strains included in the product were L. plantarum LP112, L. paracasei LPC188 and L. pentosus LPE588. ThIS study was carried out at Testing and Analysis Center for Food and Cosmetics, HungKuang University, Taichung City, Taiwan.

2.2 Genomic DNA preparation and polymerase chain reaction primers

Total chromosomal DNA of the LAB cells was extracted using Blood and Tissue Genomic DNA Extraction Miniprep System (Viogene, Taipei, Taiwan) based on the manuf-acturer’s instructions. Specific primer sequences for the LAB detection are shown in Table 1. Experiments were repeated thrice [10-12].

2.3 Polymerase chain reaction amplification

Method was carried out according to [13]. For each PCR cycle, denaturation, annealing and extension were carried out at 94 °C for 60 s, 57 °C for 60 s and 72 °C for 120 s, respectively. Final extension was carried out at 72 °C for 5 min.

2.4 Sensitivity of the polymerase chain reaction assay

A 24-h culture of the LAB strain was serially diluted 10-fold with sterile water. Purification of DNA was carried out as described in Section 2.2 [14].

2.5 Polymerase chain reaction detection in the commercial probiotic product

The probiotic product was purchased from Li-Fong, Tainan, Taiwan. After diluting the product to 108–106, 1 ml of the diluted sample was collected and DNA extraction was carried out. Then, 2 μl of the extracted DNA was used for multiplex PCR. Experiments were repeated thrice.

  1. Results and Discussion

3.1 Multiplex Polymerase chain reaction

Figure 1 shows gel electrophoresis results of the multiplex PCR for DNA detection of individual LAB strains. Results demonstrated specificity of the three primer sets for their respective target genes in each strain. Small interferences were seen for L. plantarum F7-4 with no effects on amplification of other strains. Figure 1 shows gel electrophoresis results of multiplex PCR for DNA detection of two LAB strains. Results demonstrated that L.pla-F/R, L.pen-F/R and L.para-F/R primer sets could accurately amplify DNA from combination of two LAB strains. No nonspecific products were observed. Thus, 57°C was determined as the optimal annealing temperature for successful primer binding and DNA polymerase activity.

Gel electrophoresis results validated effectiveness and specificity of the multiplex PCR for identifying and discriminating various LAB strains. These findings demonstrated applicability of the developed primer sets and verified their suitability for use in multiplex PCR. The optimized annealing temperature ensured robust amplifica-tion without nonspecific amplification products.

3.2 Sensitivity assessment of the lactic acid bacterial strains using multiplex polymerase chain reaction

In Figure 2A, DNA extracted directly from the mixed cultures of three LAB strains (109, 108 and 107 cfu ml-1) are shown. At a concentration of 106 cfu ml-1, only L. paracasei (BCRC 12188) demonstrated amplifications in multiplex PCR, indicating that detection sensitivity of L. plantarum and L. pentosus was limited to 107 cfu ml-1. Figure 2B shows mixed cultures of the three LAB strains at similar concen-trations after preculture in MRS broth (37 °C, 24 h). Multi-plex PCR detected all the three strains at a sensitivity of 106 cfu ml-1, suggesting that L. plantarum and L. pentosus proliferated and could be detected. Figure 2 shows detection limits and proliferation capabilities of the three LAB strains using multiplex PCR. Results indicated that preculture of the mixed cultures in MRS broth improves detection sensitivity, enabling accurate identification of L. plantarum and L. pentosus strains at lower concentrations.

3.3 Preculture and mixed various concentrations of lactic acid bacterial strains using multiplex polymerase chain reaction

Figure 3A shows gel electrophoresis results of the multiplex PCR carried out on DNA samples extracted from a mixture of L. plantarum (109 cfu ml-1) with two other LAB strains after preculture for 24 h. In Lanes 5–8, amplification products of L. pentosus and L. paracasei diluted to 106 cfu ml-1 were less expressed. The PCR amplification products of 106 cfu ml-1 DNA could be observed. The L. pentosus BCRC 17973 demonstrated a bacterial count of ~109 cfu ml-1 after 24 h of cultivation, whereas L. paracasei BCRC 12188 showed increased bacterial count, suggesting that preculture could enhance detection rate of low-concen-tration bacterial strains. Figure 3B shows gel electrophoresis results of the multiplex PCR on DNA extracted from a mixture of L. plantarum (108 cfu ml-1) with two other LAB strains after preculture for 24 h. The PCR products in Lanes 1–16 indicated that all the three sets of species-specific primer pairs yielded the expected PCR products for various concentrations of the bacterial suspensions after 24 h of preculture. Figure 3 shows effectiveness of the multiplex PCR in detecting L. plantarum at various concentrations in a mixed culture with other LAB strains. Results highlighted effects of preculture on enhancing assay detection rate and sensitivity.

3.4 Polymerase chain reaction detection of the commercial probiotic product

Figure 4 demonstrates results of the multiplex PCR. Whether directly detected or precultured, the three LAB strains provided DNA amplification products from 107 to 109 cfu ml-1. It was suggested that 107 cfu ml-1 was the detection limit of the product (not detected when diluted to 106 cfu ml-1).

The PCR-based species identification is a critical highly valuable tool for detecting and identifying bacteria. It offers advantages, including time efficiency and reliability in microbial identification. Compared to traditional methods such as culture-based techniques, PCR can provide results in a relatively short time. It eliminates the need of time-consuming cultivation of bacteria, allowing for further rapid identification and subsequent decision-making processes. In industrial uses, species identification is critical in selecting and developing bacterial strains appropriate for specific purposes.

Whether in food, agriculture or biotechnology industries, PCR-based species identification enables researchers to screen and select the most appropriate bacterial species for desired characteristics and functions.

The 16S rRNA gene in the ribosomal RNA of prokaryotes is the best molecular marker for bacterial evolutionary analysis. This is due to several gene characteristics, including its presence across various species, abundance, sufficient sequence length and presence of conserved and variable loci. The 16S rRNA gene is widely used in identifying lactobacilli and a commonly rapid technique for bacterial classification and identification in dairy products. Caro et al. reported that partial sequencing of 16S rRNA genes is often used for lactobacilli identification [15]. The RecA protein is a DNA recombinase that plays critical roles in DNA repair and recombination processes of bacteria. It is encoded by the recA gene in the genomes of various prokaryotic microorganisms. The recA gene and its corresponding protein have extensively been studied and used in various research, including evolutionary analysis, phylogenetic studies and identification of bacterial strains. Conserved nature and functional importance of the RecA protein make it a valuable molecular marker for understanding genetic relatedness and evolutionary relationships within bacteria. By comparing the recA gene sequences of various bacterial strains, researchers can have insights into their genetic diversity, evolutionary history and phylogenetic classification.

Lu et al. developed a multiplex PCR method that could effectively be used in key vaginal microbiota evaluation in women with bacterial vaginosis [16]. You et al. used multiplex PCR to detect six species of L. acidophilus group [17]. Petri et al. used multiplex PCR for the rapid identification of wine-associated LAB [18]. Settanni et al. introduced a method and reported its state-of-the-art uses for microbial identification in foods and beverages [19]. Sciancalepore et al. described use of a simple, low-cost, rapid sensitive method based on droplet-based multiplex PCR directly on food matrices for the simultaneous detection of bacterial genes involved in biogenic amine synthesis [20]. Specific primers were designed based on similar sequences and multiplex PCR was optimized for the simultaneous identification of L. plantarum, L. pentosus and L. paraplantarum [21]. Sul et al. developed a multiplex PCR to detect Lactobacillus and Bifidobacterium spp. in commercial probiotic products [13].

Previously, Gram-negative broth enrichment was used in studies, followed by immunomagnetic separation multiplex PCR to enable the simultaneous detection of Salmonella spp. and enterohemorrhagic Escherichia coli in food samples, irrespective of their significant discrepancy in cell counts [22]. A PCR primer set derived from the seque-nce in 16S to 23S internal transcribed spacer (ITS) region was also developed for the specific detection of B. adoles-centis in probiotics. This primer set included potentials for inspecting dairy food and environmental samples [14]. To ensure food safety during direct vat inoculation of Paocai, a propidium monoazide-based quantitative PCR method was developed to quantify L. plantarum NCU116 fermentation starter, as well as Saccharomyces spp. and potentially present pathogenic bacteria [23]. Plate counting was carried out and demonstrated similar results to quantitative PCR analysis, indicating appropriateness and effectiveness of absolute quantitative PCR for rapidly detecting microbial composition in the Paocai system [23]. In a recent study, surveillance of Lactobacillus bacteremia was carried out using biochemical and conventional-PCR assays. However, these methods could not provide target quantification and might lead to false-positive results [24]. To address this limitation, a L. rhamnosus-specific quantitative PCR assay was developed. This assay delivers accurate and reproduci-ble results, leveraging specificity of a TaqMan probe, targ-eting unique 16S rDNA sequences of L. rhamnosus [24].

  1. Conclusion

In summary, the three sets of PCR primer combinations, targeting various LAB strains, demonstrated specificity and generated the expected amplicons during PCR amplifica-tion. Use of multiplex PCR in LAB genomic detection showed potentials and was appropriate for detecting various species in food products. Multiplex PCR decreased experimental cost and time, eliminating the need of time-consuming sequencing processes. Therefore, this method is expected to contribute to the reliability of probiotic labeling systems by facilitating strain identification. This molecular technique offers a valuable tool for quality control, product development and microbial monitoring of probiotic strains in various fields.

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

Conceptualization, TCC; methodology, LZY; data curation, LZY; writing, TCC.

Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities

Jaime Marcial-Quino, José Alberto Mendoza-Espinoza, Silvia Castellanos-Castro, Rayn Clarenc Aarland, Bernarda García-Ocón, Rocío P. Montiel-Bustos, Aida Sandoval-Montaño, Fernando Díaz de León-Sánchez, Edgar Sierra-Palacios

Applied Food Biotechnology, Vol. 11 No. 1 (2024), 18 Aban 2023, Page e30
https://doi.org/10.22037/afb.v11i1.45751

Background and Objective: In the present study, a wild fungus, Hypocrea pachybasioides, has molecularly identified using ribosomal ITS5-ITS4 region as well as analysis of chemically functional groups. This fungus grows on rotten woods. This study is the first report on chemical and pharmacological activities of the fungus. The Hypocrea genus has been linked to another fungus such as Trichoderma spp., which makes it important to identify this species. There are no studies on the fungus chemical and pharmacological characteristics. The aim of the study was to identify a wild fungus through molecular methods, as well as its chemical and pharmacological identification.

Material and Methods: Compounds from methanolic extract of the mycelium and those secreted in the culture broth were assessed. First, fungal deoxyribonucleic acid was extracted for molecular identification. Qualitative assessments were carried out for compounds such as tannins, saponins and coumarins, as well as quantitative assessments for total phenols and flavonoids. High-pressure liquid chromatography analysis was carried out for organic acids. Furthermore, antiproliferative assessments were carried out using sulforhodamine B method.

Results and Conclusion: Assessments carried out on both fractions showed that compounds such as alkaloids and saponins included the highest quantities in the suggested hedonic scale. In contrast, anthraquinones were detected in lower quantities, while coumarins and tannins were not detected. Methanolic extract from mycelia showed cytotoxic activity in HeLa cell line. Therefore, Hypocrea pachybasioides can be addressed as a candidate for further pharmacological studies based on the criteria from the National Institutes of Health of the United States. This is suggested as a potentially biotechnological model for identifying various metabolites with therapeutic characteristics.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Hypocrea is a genus of fungi belonging to the class of Ascomycetes. Its species are saprophytes and predators of other fungi. There are 509 species belonging to Hypocrea genus, most of them identified by their morphological characteristics. These fungi are widely distributed and grow in tropical, subtropical, moist, arid, temperate and boreal forests. They are brightly or slightly colored and can develop on rotten woods in the form of a shelf. These fungi have been associated with other species of Ascomycota and Basidiomycota of the anamorphic type [1]. Furthermore, Hypocrea (H.) is linked to the anamorphic fungi of Trichoderma spp. since all species have been reported as phylogenetically relatives [1, 2]. All these characteristics make difficulties to identify several species belonging to Hypocrea [2]. Thus, molecular methods are useful tools for the identification of these fungi with phenotypic and genotypic complexities within the species of Hypocrea/ Trichoderma. Molecular identification is important since several species of Hypocrea (anamorph to Trichoderma) have shown activities against pathogenic fungal species such as Phytium spp., Rhizoctonia solani and Verticillium dahliae. Moreover, they can act on Botrytis cinerea, which causes the root rot of forest species, suggesting protective roles to avoid decay in fruit storage [3]. Biological control by Hypocrea spp. was verified in the treatment of pathogenic species such as Fusarium spp. of tomato crops [4]. Similarly, it has been demonstrated that the fungi synthesize chemical compounds that accelerate growth of various vegetable crops. Lo and Lin (2002) [5] reported positive effects on soil using Trichoderma (T.) harzianum for the cultivation of squash and cucumbers while Keswani et al. (2014) reported that Trichoderma spp. secreted several compounds that acted as growth regulators for horseradish, tomato, rice and tobacco [6]. In contrast, studies on compounds secreted by Hypocrea spp. have not been carried out. Since other genera such as Trichoderma are anamorph, it has been suggested that Hypocrea spp. possibly produce various compounds with simple or complex molecular structures and various chemical-biological characteristics. Secondary metabolites such as lignans, flavonoids, phenols, terpenes, sterols, alkaloids, coumarins and antibiotics with various biological characteristics can provide novel uses in various sectors of food, agrochemical and pharmaceutical industries [7].

In the present study, a wild fungus was isolated and identified as H. pachybasioides by molecular approaches. Contents of chemically functional groups such as alkaloids, saponins, anthraquinones, coumarins and tannins were analyzed as well. Moreover, total phenols and flavonoids were assessed in extracts from mycelia and those secreted into the culture broth. The cytotoxic effects of these metabolites were also investigated in three different human tumor cell lines. These data may be useful for further isolations of H. pachybasioides metabolites as potential biotechnological compounds.

  1. Materials and Methods

2.1. Fungus collection

Fungi used in this study were collected from the Sierra de Tequexquinahuac, Texcoco, Estado de Mexico. Taxo-nomic identification was carried out in the Fungi Laboratory of the Universidad Autonoma Chapingo.

2.2. Culture conditions

Collected fungi were disinfected in 1% sodium hypochlorite (v/v) solution for 10 min and then transferred into sterile distilled water (DW) (30 ml) to remove excess sodium hypochlorite. A slice of the fungi was transferred into a Petri dish with potato dextrose agar (PDA) media and incubated at 25 °C for a week (w). After growing the fungi on the plate, a mycelial disk was inoculated into 100 ml of potato dextrose broth (PDB) media and incubated at 25 °C for a week (w). Mycelia were separated from the culture media via filtration and incubated at 35 °C for 3 d. Dehydrated mycelia were pulverized using mortar and then 20 mg of the sample were used for the isolation of DNA.

2.3. DNA extraction

Briefly, DNA extraction was carried out using AxyPrep multisource genomic DNA miniprep kit (cat. AP-MN-MS-GDNA-50, Axygen, Union City, CA, USA), based on the manufacturer’s instructions. The DNA integrity was visualized on 0.7% (w/v) agarose gels stained with GelRed (Nucleic Acid Gel, Biotium; Hayward, CA, USA) using MultiDoc-It (UVP; Upland, CA, USA).

2.4. Amplification of the ITS region using PCR

The PCR reactions were prepared using the primer pair of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAA) [9]. The reaction contained 40 ng of genomic DNA, Vent enzyme buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (each 0.2 μM) and 1.25 U of Vent polymerase enzyme (BioLabs, New England Biolad, Ipswich, MA, USA) in a final volume of 50 µl. Amplification of the genes was carried out using Axigen thermal cycler (Axygen MaxyGene II Thermal Cycler, CA, USA) under the following conditions of one cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s; 5 °C for 45 s and 72°C for 1 min and then one cycle at 72 °C for 5 min. Amplicons were electrophoresed on 2% (w/v) agarose gels.

2.5. Molecular identification of Hypocrea pachybasioides

The amplified PCR products of the ITS region were cloned into the vector of pJET1.2/blunt (Thermo Scientific, USA) to achieve a complete sequence of the analyzed and unknown regions. Vectors with the inserts were transformed into competent Escherichia coli Top 10F´ cells (Invitro-genTM, Waltham, MA, USA). Plasmid DNA was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific, Waltham, MA, USA) based on the manufac-turer's instructions. Positive clones were verified through digestion with BglII to release a 550-bp fragment. In addition, clones were sequenced using primers of pJET forward (CGACTCACTATAGGGAGAGCGGC) and pJET Reverse (AAGAACATCGATTTTCCATGGCAG), which was carried out at the Instituto de Biotecnología of the Universidad Autonoma Nacional de Mexico. The sequence was analyzed through sequence comparisons of the GenBank database (NCBI) using Blast algorithm [10].

 

 

2.6. Extracellular and intracellular fungal extracts

To assess presence of chemically functional compounds e.g. alkaloids, anthraquinones, tannins, volatile coumarins and saponins. Methanol was used to achieve two extracts from the collected fungi, one from the concentrated culture broth (extracellular) and the other one from the mycelia (intracellular). Total phenolics and flavonoids were quanti-fied in the two samples. Moreover, methanol was used to isolate the metabolites. Erlenmeyer flasks with 100 ml of PDB media were inoculated with fungal mycelia and incubated at 25 °C for 10 d. Then, mycelia were separated from the culture media by filtration. Mycelia and filtered broth were dried in an oven at 35 °C for 3 d. Dried mycelia were pulverized using mortar and trans-ferred into 50 ml of methanol for 1 w. Methanolic extract was concentrated under decreased pressure using rotary evaporator.

2.7. Detection of alkaloids and anthraquinones

Thin layer chromatography (TLC) was carried out using silica gel plaques with dimensions of 3 × 5 cm (60F254) and results revealed presence of alkaloids and anthraquinones using Dragendorff reagent and UV light, respectively. An aliquot (0.5 μl) of the extract was transferred onto a plate and set in a solvent system of dichloromethane-methanol (95:5). Alkaloids were verified by the appearance of brown-red spots using Dragendorff reagent. Anthraquinones were investigated with the typical yellow or red fluorescent coloring after exposing the plates to UV light [11].

2.8. Detection of tannins and saponins

To analyze tannins in the extracts, three various solutions (10 mL) were prepared, including % (w/v) Tube 1, 1% gelatin solution; Tube 2, 1% gelatin solution and 10% NaCl; and Tube 3, 10% NaCl. Then, 2 ml of the extract were transferred into each tube and vigorously mixed using vortex. White precipitate in Tubes 1 and 2 indicated presence of tannins [11]. To assess saponins in the fungal extract, 2 ml of the samples were transferred into 10 ml of water. Tubes were heated 30 min at 80 °C and then set to cool down at room temperature (RT) and then stirred vigorously. Presence of stable foams within 15–20 min indicated presence of saponins [11].

2.9. Quantification of total phenols

To assess total phenols in the extracts, Folin-Ciocalteu reagent was used based on a protocol by [12]. Results were expressed as mg gallic acid/g dry extract (mgGAE/g) [12].

2.10. Quantification of total flavonoids

The flavonoid content was assessed using standard quercetin following the protocol [12]. Results were reported in mg quercetin/g dry extract (mgQE/g) [12].

 

 

2.11. Analysis of organic acids

Briefly, D,L-malic, oxalic and tartaric organic acids were detected in the fungal extracts using a methodology developed by [13]. Technically, 20 μl of three various samples were analyzed, including mycelia, filtered broth or the organic acid standards, which were injected into HPLC  of Agilent Technology model 1260 equipped with a quaternary pump (Agilent Technology, California, USA) with a multiple wavelength detector (MWD). The column included an X-Terra MS C18 column, 5 μm (4.6 × 250 mm) and the mobile phase consisted of phosphate buffer (50 mM, pH 2.8) in isocratic mode. The flow was adjusted to 0.7 ml/ min. Results were recorded at 210 nm and used in a standard curve. Results were expressed as parts per million.

2.12. Antiproliferative activity assay

To assess cytotoxic effects of H. pachybasioides extracts in human epithelial carcinoma (HeLa). Cell line was incubated at 37 °C in a humidified atmosphere of 5% CO2 and 100% air in complete RPMI 1640 media. Cells in the log growth phase were treated with three various concentrations of methanolic extract from the mycelia in a range of 0.032–20.0 μg/ml and incubated at 37 °C for 72 h under similar culture conditions. Each experiment was carried out in triplicate and colchicine positive control was used as an inhibitor of cell division. Cell concentration was assessed using colorimetric method and sulforhodamine B. Results were expressed as percentage of cell growth using the formula of cellular growth (%) = (At - Ab) / (Ac - Ab) × 100. Where, At was the average OD of the treatment, Ac was the average OD of the control and Ab was the average of the initial growth OD (blank) [14].

2.13. Statistical analysis

Linear regression analysis of the semi-logarithmic graphs between the concentrations and percentages of the cell growth was used. Effective concentration of the compound needed to inhibit cell proliferation by 50% (IC50 in µg/ml) was assessed using Sigma plot software [15].

  1. Results and Discussion

3.1. Fungus molecular identification

Molecular identification of the fungi usually uses nuclear DNA markers (18S and 28S ribosomal genes), spacer regions such as ITS 1 and ITS 2, external ETS and IGS intergenic [16]. Although, most of the reports on fungi identification have used the ITS region. Several genomic regions within the ITS region have been standardized and are now referred to as DNA barcodes. These barcodes are short regions, typically 400–800 base pairs (bp) [17], facilitating molecular identification of fungi. This includes anamorphic fungi, which can particularly be challenging to identify [18]. In this study, the ITS4-ITS5 region was used, including ribosomal gene region of 5.8S (Fig. 1A).

Fragment was achieved using ITS 4 forward and ITS 5 reverse primers, resulting in an amplicon of 450 bp within the expected range (Fig. 1B) [17].

Gimenez-Pereira et al. reported use of the ITS region to molecularly identify H. pseudokoningii within other filame-ntous fungi [19]. Then, the band obtained was cloned into the pJet 1.2 vector and sequenced using pJet forward and pJet reverse primers. Then, data were analyzed using Gen Bank database of the National Center for Biotechnology Information (NCBI), showing 99% identity and value of 0.0 with the sequence corresponding to H. pachybasioides (GU062213.1). This result helped molecular identification of the collected strain and a phylogenetic tree was construc-ted to show proximity of H. pachybasioides to other strains from similar species, demonstrating its close relationship majorly with other fungi of Trichoderma spp. (Fig. 2).

3.2. Chemically functional groups

Compounds such as saponins, tannins, coumarins, alkaloids, anthraquinones in the methanolic extracts from the mycelia and filtered culture media of H. pachybasioides were assessed. All these compounds have been investigated in various organisms because they include pharmacological activities. For example, alkaloids have been used as anticancer, antimicrobial, antiparasitic, antidepressant, anti-malarial, anticonvulsant and antineurodegenerative agents. Anthraquinones are other molecules associated to antiviral, analgesic, diuretic, anticancer, anti-inflammatory, anti-microbial, antiparasitic, vasorelaxant and cathartic activities [20]. Furthermore, tannins may show antitumor, anti-microbial and antioxidant activities [21]. Coumarins have been reported to include anticancer, coagulant, antiedema, anti-hypertensive, anti-hypercholesterolemic, anticoagul-ant, antimicrobial, antiviral and antihypertensive activities [22]. Saponins have shown anticancer, antidiabetic, antiviral, antiallergic, antihypercholestero-lemic, antimicro-bial and antiparasitic activities [23]. Presence of these compounds in the methanolic extracts allowed the current authors to report the first approach on the chemical compounds produced by this fungus. In mycelia, presence of alkaloids was detected at a moderate concentration, while saponins and anthraquinones were detected at lower concentrations. However, the broth extract included a large quantity of saponins and alkaloids (Table 1). Presence of the chemically functional groups highly suggests that some might present a therapeutic activity. Organic acids such as ascorbic, D,L-malic, oxalic and tartaric were enriched in the broth extract, compared to the mycelia, and presented a similar magnification as the juice extracted from Stenocereus stellatus [13] [24].

3.3. Total phenols and flavonoids quantifications

Total phenols and flavonoids were quantified, which might include significant effects on cells [24]. Quantities of total phenols and flavonoids were lower in culture broth, compared to the extract from mycelia, both from a methanolic extract (Table 1).

3.4. Cytotoxic analysis

To assess pharmacological activities, cytotoxic assess-ments were carried out using the methanolic extract from the mycelia on cell lines of MCF-7, HeLa and HCT15. So, the half maximal inhibitory concentration (IC50) was calculated by fitting curves of data from the sulforhodamine B assay (Table 1), where the antiproliferative effect was reported. Colchicine was used as control. Results showed that HeLa was the most sensitive cell line to the extract with an IC50 of 12.9 ppm while no activity was detec-ted in MCF-7 and HCT15 cells, less than 20 ppm in the assessed range. The IC50 was established as a criterion for cytotoxic activity of the crude extracts by the US national cancer institute; in which, range of 0-20 ppm is cytotoxic [25].

3.5. Relationships between the chemical compounds and cytotoxic assay

Use of fungi for the extraction of various compounds of nutritional and medicinal importance has extensively been studied. Although fungi are primary microorganisms producing metabolites, a few studies have focused on the analysis of chemically functional groups in the fungi.

Compounds with pharmacological activity have already been identified and characterized. Saponins are used as compounds with antifungal activity such as strobilurins and oudesmansins present in basidiomycetes and ascomycetes.

Endophytic fungi of medicinal plants such as Nectria, Aspergillus, Fusarium, Verticillium, Engyodontium, Plectosphaerella, Penicillium and Cladospori include these compounds, showing antifungal and antibacterial activities. Furthermore, these fungi are industrial materials to produce saponins with antimicrobial activity for use in health and agricultural sectors [26], It is noteworthy that these treatments are mostly used as mixtures. It is possible to improve effects of nano transporters [27].

It is well known that phenolics include antioxidant capacity. In this study, total phenolic compounds and flavonoids were assessed and the quantity was higher in mycelia than broth. In plants, most of the phenolics are in detected in the cytosol. This explains differences between the mycelia and broth extracts since the mycelial extract suffers cell disruption. It is useful to carry out studies on the antioxidant capacity of H. pachybasioides, as reported by Zeng et al., 2011 in two Hypocrea spp. [28]. Alkaloids include pharmacological activities such as antimicrobial, insecticidal, cytotoxic, vasoconstrictive, anti-hemorrhagic and anticancer activities. For example, ergometrine and ergoline from Claviceps spp. have shown vasoconstricting and anti-hemorrhagic activities and are used for migraine treatment. Oxalin extracted from P. oxalicum is an alkaloid with strong cytotoxic activity similar to taxol that is reported to arrest the cell cycle in M phase [29]. Reports of anthraquinones with pharmacological effects on fungi are little; however, tetrahydro-anthraquinone of Alternaria sp. XZSBG-1 has shown cytotoxic activity on cell lines of HCT-16 and HeLa while 6-8-di-O-methylveranthine isolated from A. versicolor EN-7 has shown antibacterial effects on E. coli and Staphylococcus aureus. Furthermore, T. aureoviride PSU-F95 produces two anthraquinones: coniotrantra-quinone-1 and emodine, which inhibit the growth of resistant strains of S. aureus [30].

These studies support results of the current study because with the extract from the mycelia, it was possible to report important cytotoxic activities for HeLa cell lines. Further studies are recommended to isolate specific metabolites in H. pachybasioides. Compounds with higher cytotoxic activities isolated from fungi are polysaccharides and heteropolysaccharides, which include high solubility in water and alcohols. These present better results when assessed with in vitro models on cancer cell lines [31]. The current results are aligned with this idea because it has been observed that methanolic extract of the H. pachybasioides mycelia includes antiproliferative activity for HeLa cell line. Trichoderma spp. produce such effects in Hela and HCT-7 cell lines [32]. Another important example is lipopeptaibols isolated from T. strigosum that have shown activity against various cell lines, including HCT-116 [33]. Cytotoxic activity of H. pachybasioides mycelia might be associated to high phenol contents, as occurs in S. stellatus extracts previously achieved in the current authors’ laboratory. It is suggested that phenols enhance antioxidant activity in cells. Correlations have been made between the cytotoxic effects and total phenols, antioxidant activities and cytotoxicity using the following formula: “Antioxidant capacity = a * phenols + b * D_malic + c * glucose; where, a = 0.54, b = 0.56, c = 0.28 (standard errors = 0.19, 0.20 and 0.21, respectively) and R = 0.76” [22]. This correlation with data was achieved from peels of tropical fruits: Annona squamosa L. (purple sugar apple), A. reticulata L. (custard apple), Chrysophyllum cainito L. (green star apple) and Melicoccus bijugatus Jacq. (mamoncillo) with a correlation with r2 = 0.97 (p = 0.05) with total phenols [24,34].

  1. Conclusion

In this study, a wild fungus was identified as H. pachybasioides using molecular approaches. A general study was carried out to assess various metabolites. It has been shown that methanolic extract from the mycelia caused inhibition in cell growth and substantial cytotoxic effects on HeLa cell line. This effect can be attributed to polyphenolic compounds. It is noteworthy that a few reports are available on this fungus and these data are the first data on H. pachybasioides pharmacological activity. Further studies are recommended on the purification, identification and characterization of therapeutic compounds as well as other compounds of biotechnological interest.

  1. Acknowledgements

The authors wish to acknowledge the financial support to this project of PI2013-59 (funding no. 060/2013 SECITI/UACM). The authors highly appreciate technical supports provided by Biologist Bernarda Garcia-Ocon and Claudia Ponce (CP carried out analysis of the chromatograms, the calibration curves was publication in the supporting information of the paper Chemical Profile and Study of the Antidiabetic Effect of Annona squamosa L. peel [35]). This study was a part of ESP’s sabbatical stay. It is noteworthy that this project was partially funded by SECTEI/148/2024, number 3617c24, in title “Busqueda de compuestos dirigidos contra la subunidad alfa del dimero de tubulina”.

 

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

All authors reviewed the results and approved the final version of the manuscript. Study conception and design, JMQ, JAME and ESP.