Applied Food Biotechnology
  • S'inscrire
  • Se connecter
  • Français (France)
    • English
    • فارسی
    • العربية
    • 简体中文
    • Español (España)
  • Home
  • Journal Info
    • À propos du journal
    • Comité éditorial
    • Indexation et Résumé
    • Déclaration de confidentialité
    • Examen des politiques et procedures
    • Politique anti-plagiat
    • Politique d'archivage
    • Historique de la revue
  • Issues
    • Numéro courant
    • Archives
    • Accepted Manuscripts
    • In Press
  • Publication Ethics
  • Guideline For Authors
    • Submission
    • Journal Cover Letter
    • Copyright Form
    • Conflict of Interest
  • Contact Us
##plugins.themes.ojsPlusA.frontend.header.advSearch##
  1. Accueil
  2. Archives
  3. Vol. 11 No 1 (2024): Continuous
  4. Short Communication

Vol. 11 No 1 (2024)

novembre 2023

Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities

  • Jaime Marcial-Quino
  • José Alberto Mendoza-Espinoza
  • Silvia Castellanos-Castro
  • Rayn Clarenc Aarland
  • Bernarda García-Ocón
  • Rocío P. Montiel-Bustos
  • Aida Sandoval-Montaño
  • Fernando Díaz de León-Sánchez
  • Edgar Sierra-Palacios

Applied Food Biotechnology, Vol. 11 No 1 (2024), 18 novembre 2023 , Page e30
https://doi.org/10.22037/afb.v11i1.45751 Publiée: 2024-10-01

  • ##plugins.themes.ojsPlusA.frontend.article.viewArticle##
  • Télécharger
  • ##plugins.themes.ojsPlusA.frontend.article.cite##
  • Références
  • ##plugins.themes.ojsPlusA.frontend.article.statastics##
  • ##plugins.themes.ojsPlusA.frontend.article.share##

Résumé

Background and Objective: In the present study, a wild fungus, Hypocrea pachybasioides, has molecularly identified using ribosomal ITS5-ITS4 region as well as analysis of chemically functional groups. This fungus grows on rotten woods. This study is the first report on chemical and pharmacological activities of the fungus. The Hypocrea genus has been linked to another fungus such as Trichoderma spp., which makes it important to identify this species. There are no studies on the fungus chemical and pharmacological characteristics. The aim of the study was to identify a wild fungus through molecular methods, as well as its chemical and pharmacological identification.

Material and Methods: Compounds from methanolic extract of the mycelium and those secreted in the culture broth were assessed. First, fungal deoxyribonucleic acid was extracted for molecular identification. Qualitative assessments were carried out for compounds such as tannins, saponins and coumarins, as well as quantitative assessments for total phenols and flavonoids. High-pressure liquid chromatography analysis was carried out for organic acids. Furthermore, antiproliferative assessments were carried out using sulforhodamine B method.

Results and Conclusion: Assessments carried out on both fractions showed that compounds such as alkaloids and saponins included the highest quantities in the suggested hedonic scale. In contrast, anthraquinones were detected in lower quantities, while coumarins and tannins were not detected. Methanolic extract from mycelia showed cytotoxic activity in HeLa cell line. Therefore, Hypocrea pachybasioides can be addressed as a candidate for further pharmacological studies based on the criteria from the National Institutes of Health of the United States. This is suggested as a potentially biotechnological model for identifying various metabolites with therapeutic characteristics.

Conflict of interest: The authors declare no conflict of interest.

 

  1. Introduction

 

Hypocrea is a genus of fungi belonging to the class of Ascomycetes. Its species are saprophytes and predators of other fungi. There are 509 species belonging to Hypocrea genus, most of them identified by their morphological characteristics. These fungi are widely distributed and grow in tropical, subtropical, moist, arid, temperate and boreal forests. They are brightly or slightly colored and can develop on rotten woods in the form of a shelf. These fungi have been associated with other species of Ascomycota and Basidiomycota of the anamorphic type [1]. Furthermore, Hypocrea (H.) is linked to the anamorphic fungi of Trichoderma spp. since all species have been reported as phylogenetically relatives [1, 2]. All these characteristics make difficulties to identify several species belonging to Hypocrea [2]. Thus, molecular methods are useful tools for the identification of these fungi with phenotypic and genotypic complexities within the species of Hypocrea/ Trichoderma. Molecular identification is important since several species of Hypocrea (anamorph to Trichoderma) have shown activities against pathogenic fungal species such as Phytium spp., Rhizoctonia solani and Verticillium dahliae. Moreover, they can act on Botrytis cinerea, which causes the root rot of forest species, suggesting protective roles to avoid decay in fruit storage [3]. Biological control by Hypocrea spp. was verified in the treatment of pathogenic species such as Fusarium spp. of tomato crops [4]. Similarly, it has been demonstrated that the fungi synthesize chemical compounds that accelerate growth of various vegetable crops. Lo and Lin (2002) [5] reported positive effects on soil using Trichoderma (T.) harzianum for the cultivation of squash and cucumbers while Keswani et al. (2014) reported that Trichoderma spp. secreted several compounds that acted as growth regulators for horseradish, tomato, rice and tobacco [6]. In contrast, studies on compounds secreted by Hypocrea spp. have not been carried out. Since other genera such as Trichoderma are anamorph, it has been suggested that Hypocrea spp. possibly produce various compounds with simple or complex molecular structures and various chemical-biological characteristics. Secondary metabolites such as lignans, flavonoids, phenols, terpenes, sterols, alkaloids, coumarins and antibiotics with various biological characteristics can provide novel uses in various sectors of food, agrochemical and pharmaceutical industries [7].

In the present study, a wild fungus was isolated and identified as H. pachybasioides by molecular approaches. Contents of chemically functional groups such as alkaloids, saponins, anthraquinones, coumarins and tannins were analyzed as well. Moreover, total phenols and flavonoids were assessed in extracts from mycelia and those secreted into the culture broth. The cytotoxic effects of these metabolites were also investigated in three different human tumor cell lines. These data may be useful for further isolations of H. pachybasioides metabolites as potential biotechnological compounds.

  1. Materials and Methods

2.1. Fungus collection

Fungi used in this study were collected from the Sierra de Tequexquinahuac, Texcoco, Estado de Mexico. Taxo-nomic identification was carried out in the Fungi Laboratory of the Universidad Autonoma Chapingo.

2.2. Culture conditions

Collected fungi were disinfected in 1% sodium hypochlorite (v/v) solution for 10 min and then transferred into sterile distilled water (DW) (30 ml) to remove excess sodium hypochlorite. A slice of the fungi was transferred into a Petri dish with potato dextrose agar (PDA) media and incubated at 25 °C for a week (w). After growing the fungi on the plate, a mycelial disk was inoculated into 100 ml of potato dextrose broth (PDB) media and incubated at 25 °C for a week (w). Mycelia were separated from the culture media via filtration and incubated at 35 °C for 3 d. Dehydrated mycelia were pulverized using mortar and then 20 mg of the sample were used for the isolation of DNA.

2.3. DNA extraction

Briefly, DNA extraction was carried out using AxyPrep multisource genomic DNA miniprep kit (cat. AP-MN-MS-GDNA-50, Axygen, Union City, CA, USA), based on the manufacturer’s instructions. The DNA integrity was visualized on 0.7% (w/v) agarose gels stained with GelRed (Nucleic Acid Gel, Biotium; Hayward, CA, USA) using MultiDoc-It (UVP; Upland, CA, USA).

2.4. Amplification of the ITS region using PCR

The PCR reactions were prepared using the primer pair of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAA) [9]. The reaction contained 40 ng of genomic DNA, Vent enzyme buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (each 0.2 μM) and 1.25 U of Vent polymerase enzyme (BioLabs, New England Biolad, Ipswich, MA, USA) in a final volume of 50 µl. Amplification of the genes was carried out using Axigen thermal cycler (Axygen MaxyGene II Thermal Cycler, CA, USA) under the following conditions of one cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s; 5 °C for 45 s and 72°C for 1 min and then one cycle at 72 °C for 5 min. Amplicons were electrophoresed on 2% (w/v) agarose gels.

2.5. Molecular identification of Hypocrea pachybasioides

The amplified PCR products of the ITS region were cloned into the vector of pJET1.2/blunt (Thermo Scientific, USA) to achieve a complete sequence of the analyzed and unknown regions. Vectors with the inserts were transformed into competent Escherichia coli Top 10F´ cells (Invitro-genTM, Waltham, MA, USA). Plasmid DNA was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific, Waltham, MA, USA) based on the manufac-turer's instructions. Positive clones were verified through digestion with BglII to release a 550-bp fragment. In addition, clones were sequenced using primers of pJET forward (CGACTCACTATAGGGAGAGCGGC) and pJET Reverse (AAGAACATCGATTTTCCATGGCAG), which was carried out at the Instituto de Biotecnología of the Universidad Autonoma Nacional de Mexico. The sequence was analyzed through sequence comparisons of the GenBank database (NCBI) using Blast algorithm [10].

 

 

2.6. Extracellular and intracellular fungal extracts

To assess presence of chemically functional compounds e.g. alkaloids, anthraquinones, tannins, volatile coumarins and saponins. Methanol was used to achieve two extracts from the collected fungi, one from the concentrated culture broth (extracellular) and the other one from the mycelia (intracellular). Total phenolics and flavonoids were quanti-fied in the two samples. Moreover, methanol was used to isolate the metabolites. Erlenmeyer flasks with 100 ml of PDB media were inoculated with fungal mycelia and incubated at 25 °C for 10 d. Then, mycelia were separated from the culture media by filtration. Mycelia and filtered broth were dried in an oven at 35 °C for 3 d. Dried mycelia were pulverized using mortar and trans-ferred into 50 ml of methanol for 1 w. Methanolic extract was concentrated under decreased pressure using rotary evaporator.

2.7. Detection of alkaloids and anthraquinones

Thin layer chromatography (TLC) was carried out using silica gel plaques with dimensions of 3 × 5 cm (60F254) and results revealed presence of alkaloids and anthraquinones using Dragendorff reagent and UV light, respectively. An aliquot (0.5 μl) of the extract was transferred onto a plate and set in a solvent system of dichloromethane-methanol (95:5). Alkaloids were verified by the appearance of brown-red spots using Dragendorff reagent. Anthraquinones were investigated with the typical yellow or red fluorescent coloring after exposing the plates to UV light [11].

2.8. Detection of tannins and saponins

To analyze tannins in the extracts, three various solutions (10 mL) were prepared, including % (w/v) Tube 1, 1% gelatin solution; Tube 2, 1% gelatin solution and 10% NaCl; and Tube 3, 10% NaCl. Then, 2 ml of the extract were transferred into each tube and vigorously mixed using vortex. White precipitate in Tubes 1 and 2 indicated presence of tannins [11]. To assess saponins in the fungal extract, 2 ml of the samples were transferred into 10 ml of water. Tubes were heated 30 min at 80 °C and then set to cool down at room temperature (RT) and then stirred vigorously. Presence of stable foams within 15–20 min indicated presence of saponins [11].

2.9. Quantification of total phenols

To assess total phenols in the extracts, Folin-Ciocalteu reagent was used based on a protocol by [12]. Results were expressed as mg gallic acid/g dry extract (mgGAE/g) [12].

2.10. Quantification of total flavonoids

The flavonoid content was assessed using standard quercetin following the protocol [12]. Results were reported in mg quercetin/g dry extract (mgQE/g) [12].

 

 

2.11. Analysis of organic acids

Briefly, D,L-malic, oxalic and tartaric organic acids were detected in the fungal extracts using a methodology developed by [13]. Technically, 20 μl of three various samples were analyzed, including mycelia, filtered broth or the organic acid standards, which were injected into HPLC  of Agilent Technology model 1260 equipped with a quaternary pump (Agilent Technology, California, USA) with a multiple wavelength detector (MWD). The column included an X-Terra MS C18 column, 5 μm (4.6 × 250 mm) and the mobile phase consisted of phosphate buffer (50 mM, pH 2.8) in isocratic mode. The flow was adjusted to 0.7 ml/ min. Results were recorded at 210 nm and used in a standard curve. Results were expressed as parts per million.

2.12. Antiproliferative activity assay

To assess cytotoxic effects of H. pachybasioides extracts in human epithelial carcinoma (HeLa). Cell line was incubated at 37 °C in a humidified atmosphere of 5% CO2 and 100% air in complete RPMI 1640 media. Cells in the log growth phase were treated with three various concentrations of methanolic extract from the mycelia in a range of 0.032–20.0 μg/ml and incubated at 37 °C for 72 h under similar culture conditions. Each experiment was carried out in triplicate and colchicine positive control was used as an inhibitor of cell division. Cell concentration was assessed using colorimetric method and sulforhodamine B. Results were expressed as percentage of cell growth using the formula of cellular growth (%) = (At - Ab) / (Ac - Ab) × 100. Where, At was the average OD of the treatment, Ac was the average OD of the control and Ab was the average of the initial growth OD (blank) [14].

2.13. Statistical analysis

Linear regression analysis of the semi-logarithmic graphs between the concentrations and percentages of the cell growth was used. Effective concentration of the compound needed to inhibit cell proliferation by 50% (IC50 in µg/ml) was assessed using Sigma plot software [15].

  1. Results and Discussion

3.1. Fungus molecular identification

Molecular identification of the fungi usually uses nuclear DNA markers (18S and 28S ribosomal genes), spacer regions such as ITS 1 and ITS 2, external ETS and IGS intergenic [16]. Although, most of the reports on fungi identification have used the ITS region. Several genomic regions within the ITS region have been standardized and are now referred to as DNA barcodes. These barcodes are short regions, typically 400–800 base pairs (bp) [17], facilitating molecular identification of fungi. This includes anamorphic fungi, which can particularly be challenging to identify [18]. In this study, the ITS4-ITS5 region was used, including ribosomal gene region of 5.8S (Fig. 1A).

Fragment was achieved using ITS 4 forward and ITS 5 reverse primers, resulting in an amplicon of 450 bp within the expected range (Fig. 1B) [17].

Gimenez-Pereira et al. reported use of the ITS region to molecularly identify H. pseudokoningii within other filame-ntous fungi [19]. Then, the band obtained was cloned into the pJet 1.2 vector and sequenced using pJet forward and pJet reverse primers. Then, data were analyzed using Gen Bank database of the National Center for Biotechnology Information (NCBI), showing 99% identity and value of 0.0 with the sequence corresponding to H. pachybasioides (GU062213.1). This result helped molecular identification of the collected strain and a phylogenetic tree was construc-ted to show proximity of H. pachybasioides to other strains from similar species, demonstrating its close relationship majorly with other fungi of Trichoderma spp. (Fig. 2).

3.2. Chemically functional groups

Compounds such as saponins, tannins, coumarins, alkaloids, anthraquinones in the methanolic extracts from the mycelia and filtered culture media of H. pachybasioides were assessed. All these compounds have been investigated in various organisms because they include pharmacological activities. For example, alkaloids have been used as anticancer, antimicrobial, antiparasitic, antidepressant, anti-malarial, anticonvulsant and antineurodegenerative agents. Anthraquinones are other molecules associated to antiviral, analgesic, diuretic, anticancer, anti-inflammatory, anti-microbial, antiparasitic, vasorelaxant and cathartic activities [20]. Furthermore, tannins may show antitumor, anti-microbial and antioxidant activities [21]. Coumarins have been reported to include anticancer, coagulant, antiedema, anti-hypertensive, anti-hypercholesterolemic, anticoagul-ant, antimicrobial, antiviral and antihypertensive activities [22]. Saponins have shown anticancer, antidiabetic, antiviral, antiallergic, antihypercholestero-lemic, antimicro-bial and antiparasitic activities [23]. Presence of these compounds in the methanolic extracts allowed the current authors to report the first approach on the chemical compounds produced by this fungus. In mycelia, presence of alkaloids was detected at a moderate concentration, while saponins and anthraquinones were detected at lower concentrations. However, the broth extract included a large quantity of saponins and alkaloids (Table 1). Presence of the chemically functional groups highly suggests that some might present a therapeutic activity. Organic acids such as ascorbic, D,L-malic, oxalic and tartaric were enriched in the broth extract, compared to the mycelia, and presented a similar magnification as the juice extracted from Stenocereus stellatus [13] [24].

3.3. Total phenols and flavonoids quantifications

Total phenols and flavonoids were quantified, which might include significant effects on cells [24]. Quantities of total phenols and flavonoids were lower in culture broth, compared to the extract from mycelia, both from a methanolic extract (Table 1).

3.4. Cytotoxic analysis

To assess pharmacological activities, cytotoxic assess-ments were carried out using the methanolic extract from the mycelia on cell lines of MCF-7, HeLa and HCT15. So, the half maximal inhibitory concentration (IC50) was calculated by fitting curves of data from the sulforhodamine B assay (Table 1), where the antiproliferative effect was reported. Colchicine was used as control. Results showed that HeLa was the most sensitive cell line to the extract with an IC50 of 12.9 ppm while no activity was detec-ted in MCF-7 and HCT15 cells, less than 20 ppm in the assessed range. The IC50 was established as a criterion for cytotoxic activity of the crude extracts by the US national cancer institute; in which, range of 0-20 ppm is cytotoxic [25].

3.5. Relationships between the chemical compounds and cytotoxic assay

Use of fungi for the extraction of various compounds of nutritional and medicinal importance has extensively been studied. Although fungi are primary microorganisms producing metabolites, a few studies have focused on the analysis of chemically functional groups in the fungi.

Compounds with pharmacological activity have already been identified and characterized. Saponins are used as compounds with antifungal activity such as strobilurins and oudesmansins present in basidiomycetes and ascomycetes.

Endophytic fungi of medicinal plants such as Nectria, Aspergillus, Fusarium, Verticillium, Engyodontium, Plectosphaerella, Penicillium and Cladospori include these compounds, showing antifungal and antibacterial activities. Furthermore, these fungi are industrial materials to produce saponins with antimicrobial activity for use in health and agricultural sectors [26], It is noteworthy that these treatments are mostly used as mixtures. It is possible to improve effects of nano transporters [27].

It is well known that phenolics include antioxidant capacity. In this study, total phenolic compounds and flavonoids were assessed and the quantity was higher in mycelia than broth. In plants, most of the phenolics are in detected in the cytosol. This explains differences between the mycelia and broth extracts since the mycelial extract suffers cell disruption. It is useful to carry out studies on the antioxidant capacity of H. pachybasioides, as reported by Zeng et al., 2011 in two Hypocrea spp. [28]. Alkaloids include pharmacological activities such as antimicrobial, insecticidal, cytotoxic, vasoconstrictive, anti-hemorrhagic and anticancer activities. For example, ergometrine and ergoline from Claviceps spp. have shown vasoconstricting and anti-hemorrhagic activities and are used for migraine treatment. Oxalin extracted from P. oxalicum is an alkaloid with strong cytotoxic activity similar to taxol that is reported to arrest the cell cycle in M phase [29]. Reports of anthraquinones with pharmacological effects on fungi are little; however, tetrahydro-anthraquinone of Alternaria sp. XZSBG-1 has shown cytotoxic activity on cell lines of HCT-16 and HeLa while 6-8-di-O-methylveranthine isolated from A. versicolor EN-7 has shown antibacterial effects on E. coli and Staphylococcus aureus. Furthermore, T. aureoviride PSU-F95 produces two anthraquinones: coniotrantra-quinone-1 and emodine, which inhibit the growth of resistant strains of S. aureus [30].

These studies support results of the current study because with the extract from the mycelia, it was possible to report important cytotoxic activities for HeLa cell lines. Further studies are recommended to isolate specific metabolites in H. pachybasioides. Compounds with higher cytotoxic activities isolated from fungi are polysaccharides and heteropolysaccharides, which include high solubility in water and alcohols. These present better results when assessed with in vitro models on cancer cell lines [31]. The current results are aligned with this idea because it has been observed that methanolic extract of the H. pachybasioides mycelia includes antiproliferative activity for HeLa cell line. Trichoderma spp. produce such effects in Hela and HCT-7 cell lines [32]. Another important example is lipopeptaibols isolated from T. strigosum that have shown activity against various cell lines, including HCT-116 [33]. Cytotoxic activity of H. pachybasioides mycelia might be associated to high phenol contents, as occurs in S. stellatus extracts previously achieved in the current authors’ laboratory. It is suggested that phenols enhance antioxidant activity in cells. Correlations have been made between the cytotoxic effects and total phenols, antioxidant activities and cytotoxicity using the following formula: “Antioxidant capacity = a * phenols + b * D_malic + c * glucose; where, a = 0.54, b = 0.56, c = 0.28 (standard errors = 0.19, 0.20 and 0.21, respectively) and R = 0.76” [22]. This correlation with data was achieved from peels of tropical fruits: Annona squamosa L. (purple sugar apple), A. reticulata L. (custard apple), Chrysophyllum cainito L. (green star apple) and Melicoccus bijugatus Jacq. (mamoncillo) with a correlation with r2 = 0.97 (p = 0.05) with total phenols [24,34].

  1. Conclusion

In this study, a wild fungus was identified as H. pachybasioides using molecular approaches. A general study was carried out to assess various metabolites. It has been shown that methanolic extract from the mycelia caused inhibition in cell growth and substantial cytotoxic effects on HeLa cell line. This effect can be attributed to polyphenolic compounds. It is noteworthy that a few reports are available on this fungus and these data are the first data on H. pachybasioides pharmacological activity. Further studies are recommended on the purification, identification and characterization of therapeutic compounds as well as other compounds of biotechnological interest.

  1. Acknowledgements

The authors wish to acknowledge the financial support to this project of PI2013-59 (funding no. 060/2013 SECITI/UACM). The authors highly appreciate technical supports provided by Biologist Bernarda Garcia-Ocon and Claudia Ponce (CP carried out analysis of the chromatograms, the calibration curves was publication in the supporting information of the paper Chemical Profile and Study of the Antidiabetic Effect of Annona squamosa L. peel [35]). This study was a part of ESP’s sabbatical stay. It is noteworthy that this project was partially funded by SECTEI/148/2024, number 3617c24, in title “Busqueda de compuestos dirigidos contra la subunidad alfa del dimero de tubulina”.

 

  1. Conflict of Interest

The authors report no conflict of interest.

  1. Authors Contributions

All authors reviewed the results and approved the final version of the manuscript. Study conception and design, JMQ, JAME and ESP.

Mots-clés:
  • Molecular methods
  • H. pachybasioides
  • ITS-region
  • Cytotoxic
Identification and valuation of H. pachybasioides_
  • pdf (English)

Comment citer

Marcial-Quino, J., Mendoza-Espinoza, J. A., Castellanos-Castro, S., Aarland, R. C., García-Ocón, B., Montiel-Bustos, R. P., … Sierra-Palacios, E. (2024). Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities. Applied Food Biotechnology, 11(1), e30. https://doi.org/10.22037/afb.v11i1.45751
  • ACM
  • ACS
  • APA
  • ABNT
  • Chicago
  • Harvard
  • IEEE
  • MLA
  • Turabian
  • Vancouver
  • Endnote/Zotero/Mendeley (RIS)
  • BibTeX

Références

Chaverri P, Samuels GJ, Stewart EL. Hypocrea virens sp. nov., the teleomorph of Trichoderma virens. Mycologia. 2021; 93(6): 1113-1124.

https://doi.org/10.1080/00275514.2001.12063245

Jaklitsch WM, Komon M, Kubicek CP, Druzhinina IS. Hypocrea crystalligena sp. nov., a common European species with a white-spored Trichoderma anamorph. Mycologia. 2006; 98(3): 499-513.

https://doi.org/10.3852/mycologia.98.3.499

Gal-Hemed I, Atanasova L, Komon-Zelazowska M, Druzhinina IS, Viterbo A, Yarden O. Marine isolates of Trichoderma spp. as potential halotolerant agents of biological control for arid-zone agriculture. Appl Environ Microbiol. 2011; 77(15): 5100-5109.

https://doi.org/10.1128/AEM.00541-11

Larkin RP, Fravel DR. Mechanisms of action and dose-response relationships governing biological control of Fusarium wilt of tomato by nonpathogenic Fusarium spp. Phytopathology. 1999; 89(12): 1152-1161.

https://doi.org/10.1094/PHYTO.1999.89.12.1152

Lo CT, Lin CY. Screening strains of Trichoderma spp for plant growth enhancement in Taiwan. Plant Pathol Bull. 2002; 11: 215-220.

Keswani C, Mishra S, Sarma BK, Singh SP, Singh HB. Unraveling the efficient applications of secondary metabolites of various Trichoderma spp. Appl Microbiol Biotechnol. 2014; 98(2): 533-544.

https://doi.org/10.1007/s00253-013-5344-5

Khan RAA, Najeeb S, Hussain S, Xie B, Li Y. Bioactive secondary metabolites from Trichoderma spp. against phytopathogenic fungi. Microorganisms. 2020; 8(6): 817.

https://doi.org/10.3390/microorganisms8060817

Villa JM, Sierra-Palacios E, Díaz de León-Sánchez F, Pérez-Flores LJ, Mendoza-Espinoza JA. Molecular biology techniques as new alternatives for medicinal plant identification. Phyton. 2018; 87: 72-78.

https://doi.org/10.32604/phyton.2018.87.072

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990; 215(3): 403-410.

https://doi.org/10.1016/S0022-2836(05)80360-2

Aarland RC, Peralta-Gómez S, Morales-Sánchez C, Parra-Bustamante F, Villa-Hernández JM, Díaz de León-Sánchez F, Pérez-Flores LJ, Rivera-Cabrera F, Mendoza-Espinoza JA. A pharmacological and phytochemical study of medicinal plants used in Mexican folk medicine. Indian J Tradit Knowle. 2015; 14(4): 550-557.

Gomez-Covarrubias SI, Mendoza-Espinoza JA, Sierra-Palacios E, Alvarez-Ramirez E, Aarland RC, Rivera-Cabrera F, Bustamante-Camilo P, Gomez-Cansino R, Diaz de Leon-Sanchez F. Effects of pasteurization on antihyperglycemic and chemical parameter of Xoconostle (Stenocereus stellatus) juice. Appl Food Biotechnol. 2024; 11(1): e4.

http://doi.org/10.22037/afb.v11i1.43252

Díaz de León-Sánchez F, Hernández-Trigueros PD, Verástegui-Rodríguez LL, Oidor-Chang VO, Cervantes-Arista C, Aarland RC, Sierra-Palacios E, Mendoza-Espinoza JA. Chemical composition of juice and antihyperglycemic studies in seed of the prehispanic fruit tunillo (Stenocereus stellatus) collected in Oaxaca, Mexico. Indian J Tradit Knowle. 2020; 19(3): 580-584.

Choudhary PK, Khandelwal V, Gupta S, Chaubey KK, Singh SV, Goel A, Bhatia AK. Immunosuppressive and anti-cancer potential of aqueous extract of Solanum Xanthocarpum. Indian J Tradit Knowle. 2019; 18(3). 451-457.

Valdez-Morales M, Sandoval-Castro CJ, Mendoza-Espinoza JA, Gutiérrez-Dorado R, Medina-Godoy S. Oil recovery from Jalapeño pepper by-products and analysis of the industrial scalding process on its nutraceutical potential. Waste Biomass Valor. 2021; 12: 4475-4487.

https://doi.org/10.1007/s12649-020-01323-8

Khan AM, Bhadauria S. Molecular characterization of keratin degrading fungi isolated from semi-arid soil by PCR using ITS4 and ITS5 primers. J King Saud Univ Sci. 2019; 31(4): 1418-1423.

https://doi.org/10.1016/j.jksus.2018.04.014

Kress WJ, Erickson DL. DNA barcodes: Methods and protocols. Methods Mol Biol. 2012; 858: 3-8.

https://doi.org/10.1007/978-1-61779-591-6_1.18

Raja HA, Miller AN, Pearce CJ, Oberlies NH. Fungal identif-ication using molecular tools: A primer for the natural products research community. J Nat Prod. 2017; 80(3): 756-770.

https://doi.org/10.1021/acs.jnatprod.6b01085

Giménez-Pereira M, Vici AC, Facchini F, Padua-Tristão A, Cursino-Santos JR, Rodrigo Sanchez P, Atílio J, Teixeira de Morales Polizeli ML. Screening of filamentous fungi for lipase production: Hypocrea pseudokoningii a new producer with a high biotechnological potential. Biocatal Biotransform. 2014; 32: 74-83.

https://doi.org/10.3109/10242422.2013.873417

Dave H, Ledwani L. A review on anthraquinones isolated from cassia species and their applications. Indian J Nat Prod Resour. 2012; 291-319.

Okuda T, Ito H. Tannins of constant structure in medicinal and food plants-hydrolyzable tannins and polyphenols related to tannins. Molecules. 2011; 16(3): 2191-2217.

https://doi.org/10.3390/molecules16032191

Venugopala KN, Rashmi V, Odhav B. Review on natural coumarin lead compounds for their pharmacological activity. Biomed Res Int. 2013; 2013: 963248.

https://doi.org/10.1155/2013/963248

Juang YP, Liang PH. Biological and pharmacological effects of synthetic saponins. Molecules. 2020; 25(21): 4974.

https://doi.org/10.3390/molecules25214974

Cervantes-Arista C, Román-Guerrero A, Oidor-Chan VH, Díaz de León-Sánchez F, Álvarez-Ramírez EL, Pelayo-Zaldívar C, Sierra-Palacios E, Mendoza-Espinoza JA. Chemic-al characterization, antioxidant capacity and anti-hyperglyce-mic effect of Stenocereus stellatus fruits from the arid Mixteca Baja region of Mexico. Food Chem. 2020; 328: 127076.

https://doi.org/10.1016/j.foodchem.2020.127076

Perea-Domínguez XP, Mendoza-Espinoza JA, Solano Gonzá-lez JM, Leyva-Morales JB, Espinosa-Alonso LG, Valdez-Morales M. Antioxidant and anti-proliferative activity of free, conjugates and bound phenolic compounds from tomato and industrial tomato by-product. J Food Sci Technol. 2022; 59(6): 2361-2369.

https://doi.org/10.1007/s13197-021-05252-9

Wu H, Yang HY, You XL, Li YH. Diversity of endophytic fungi from roots of Panax ginseng and their saponin yield capacities. Springerplus. 2013; 2(1): 107.

https://doi.org/10.1186/2193-1801-2-107

Zhao M, van Straten D, Broekman MLD, Préat V, Schiffelers RM. Nanocarrier-based drug combination therapy for gliobla-stoma. Theranostics. 2020; 10(3): 1355-1372.

https://doi.org/10.7150/thno.38147

Zeng PY, Wu JG, Liao LM, Chen TQ, Wu JZ, Wong KH. In vitro antioxidant activities of endophytic fungi isolated from the liverwort Scapania verrucose. Genet Mol Res. 2011; 10(4): 3169-3179.

https://doi.org/10.4238/2011.December.20.1

Koizumi Y, Arai M, Tomoda H, Ōmura S. Oxaline, a fungal alkaloid, arrests the cell cycle in M phase by inhibition of tubulin polymerization. Biochim Biophys Acta. 2004; 1693 (1): 47-55.

https://doi.org/10.1016/j.bbamcr.2004.04.013

Zhang Y, LI XM, Wang B. Anthraquinone derivatives produc-ed by marine-derived fungus Aspergillus versicolor EN-7. Biosci Biotechnol Biochem. 2012; 76(9): 1774-1776.

https://doi.org/10.1271/bbb.120047

Tomasi S, Lohezic-Le Devehat, F, Sauleau P, Bézivin C, Boustie J. Cytotoxic Activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines. Die Pharm Int J Pharm Sci. 2004; 59: 290-293.

El-Rahman AA, El-Shafei SM, Ivanova EV, Fattakhova AN, Pankova AV, El-Shafei M, El-Morsi, E. and Alimova, F.K. Cytotoxicity of Trichoderma spp. cultural filtrate against human cervical and breast cancer cell lines. Asian Pacific J Cancer Prev. 2014; 15(17): 7229-7234.

https://doi.org/10.7314/APJCP.2014.15.17.7229

Park YS, Kim ES, Deyrup ST, Lee JW, Shim SH. Cytotoxic peptaibols from Trichoderma strigosum. J Nat Prod. 2024; 87(8): 2081-2094.

https://doi.org/10.1021/acs.jnatprod.4c00590

Chel-Guerrero LD, Gómez-Cansino R, Guzmán-Gutiérrez S, Campos-Lara MG, Saury-Duch E, Díaz de León-Sánchez F, Reyes-Chilpa R, Mendoza-Espinoza JA. In vitro antiviral activity and phytochemical screen in the extracts of peels from four species of tropical fruits collected in Merida Yucatan, Mexico. Phyton. 2018; 87: 68-71.

https://doi.org/10.32604/phyton.2018.87.068

Ponce-Sánchez C, Oidor-Chan VH, Álvarez-Ramírez EL. et al. Chemical profile and study of the antidiabetic effect of Annona squamosa L. Peel. Waste Biomass Valor. 2024; 15:1053-1063.

https://doi.org/10.1007/s12649-023-02217-1

  • Résumé ##plugins.themes.ojsPlusA.frontend.article.viewed##: 395 ##plugins.themes.ojsPlusA.frontend.article.times##
  • pdf (English) ##plugins.themes.ojsPlusA.frontend.article.downloaded##: 206 ##plugins.themes.ojsPlusA.frontend.article.times##

##plugins.themes.ojsPlusA.frontend.article.downloadstatastics##

  • ##plugins.themes.ojsPlusA.frontend.article.linkedin##
  • ##plugins.themes.ojsPlusA.frontend.article.twitter##
  • ##plugins.themes.ojsPlusA.frontend.article.facebook##
  • ##plugins.themes.ojsPlusA.frontend.article.googleplus##
  • ##plugins.themes.ojsPlusA.frontend.article.telegram##

Développé par

Open Journal Systems

Langue

  • English
  • فارسی
  • العربية
  • 简体中文
  • Español (España)
  • Français (France)

Informations

  • Pour les lecteurs
  • Pour les auteurs
  • Pour les bibliothécaires
  • ##plugins.themes.ojsPlusA.frontend.footer.home##
  • Archives
  • Soumissions
  • À propos de cette revue
  • Comité éditorial
  • Contact

AWT IMAGE

The journal of "Applied Food Biotechnology" is licensed under a  CC BY-NC 4.0. International License.

##plugins.themes.ojsPlusA.frontend.copyright##