Narges Zali, Seyed
Reza Mohebbi, Sahar Esteghamati, Farzad Firouzi, Seyed Mohammad Kazem
Hosseini Asl, Mohsen Chiani, Faramarz Derakhshan, Amir Houshang Mohammad
Alizadeh, Seyed Ali Malek Hosseini, Mohammad Reza Zali
Research Centre for
Gastroenterology and Liver Diseases,
ABSTRACT
Aim:
To
investigate the
ATP7B gene in ethnically different Iranian patients with
Background:
Copper transporting beta polypeptide, ATP7B or WND gene is predominantly
expressed in liver and has been identified as the defective gene. WND gene
is located on Chr13q14.3 and consists of 21 expressed exons.
Patients and methods:
Diagnosis of WD was verified according to the biochemical characterizations
including serum ceroluplasmin (<0.2g/l), 24-hour urine copper after
challenging by D-penicillamine (>25mmol/24h), liver copper (>250µg/g dry
weight), Kayser-Fleischer rings, Cu-ATPase activity, and liver and brain
imaging features. A total of 70 patients aged 5-40 years, were included.
Patients were classified in three different categories; hepatic, neurologic
and combined based on their clinical presentations. Bi-directional
sequencing was performed using the ABI 3130xl, Genetic analyzer (Applied-Biosystem).
Results:
Totally, 12 different mutations have been found in 18 patients with Wilson's
disease. Of these, T788I, 2803-2805 ACG>-TG, 2532delA and H1069N were novel
mutations. Meanwhile, we have found 4 polymorphisms.
Conclusion:
Mutations are highly distributed among the different exons of ATP7B gene in
Iranian patients with WD.
Keywords:
ATP7B gene,
(Gastroenterology and Hepatology from bed to bench 2008;1(1):3-9).
INTRODUCTION
Wilson's
disease (WD), an autosomal recessive disorder with incidence of 1 in 30,000 (1
in 5000 to 1 in 30,000), is characterized by excessive copper accumulation in
liver and brain. Abnormal accumulation in liver can induce asymptomatic rise of
enzymes or major clinical illnesses such as, chronic active hepatitis, liver
cirrhosis, and fulminant acute hepatic failure with or without intravenous
hemolysis (1-3). Excessive copper in the brain induces neurological dysfunction
such as bradykinesia, rigidity, tremor, chorea and dystonia. KF ring (Kayser
Fleischer) is an important eye sign
almost universally present in
Copper transporting beta
polypeptide, ATP7B or WND gene (OMIM#277900), is predominantly expressed in
liver, and has been identified as the defective gene. WND gene is located on
Chr13q14.3 and consists of 21 expressed exons (10,11). It spans 80 kb of genomic
sequence encoding a protein with several membrane-spanning domains, an ATPase
consensus sequence, a hinge domain, a phosphorylation site, and at least 2
putative copper-binding sites. This protein functions as a monomer, exporting
copper out of the cells, such as the efflux of hepatic copper into the bile.
Alternate transcriptional splice variants, encoding different isoforms with
distinct cellular localizations, have been characterized (12).
To date, more than 250
diseases causing mutations have been reported in ATP7B gene that are widely
distributed among its different exons, however, of which 25% are located in its
ATP-binding domain. Furthermore, these mutations are due to splice-site, small
insertions/deletions, non-sense and missense mutations in a frequency of 7.4%,
27.0%, 7.4% and 58.2%, respectively (13). It should be noted, some of these
mutations are population specific and much prevalent in a particular population
such as, either H1069Q in European or R778L in Asian population (14).
With respect to the numerous
reported mutations in ATP7B gene, as well as lack of the information regarding
the WND mutations in Iranian population, we decided to investigate the ATP7B
gene in ethnically different Iranian patients with
PATIENTS and METHODS
We included all WD patients
referring to
Diagnosis of WD was verified
according to the biochemical characterizations including serum ceroluplasmin
(<0.2g/l), 24-hour urine copper after challenging by D-penicillamine
(>25mmol/24h), liver copper (>250µg/g dry weight), Kayser-Fleischer rings, Cu-ATPase
activity, and liver and brain imaging features. Patients who met two of the
aforementioned features entered the study. Meanwhile all patients were checked
for abnormal liver enzymes, including alkaline phosphatase (ALK.P), aspartate
aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin,
direct bilirubin, albumin, international normalized ratio (INR), and prothrombin
time (PT). A total of 70 patients aged 5-40 years, were included. Patients were
classified in three different categories, hepatic (58 cases), neurologic (5
cases) and combined (7 cases) based on their clinical presentations. Hepatic
patients had liver involvement. Neurological patients had neurological symptoms
such as tremor, clumsiness, dysarthria, and ataxia in addition to dystonic or
parkinsonian syndrome. Mixed-type patients were diagnosed based on liver
involvement and neurological features.
Table 1.
Primers, their sequence, annealing temperature and extension time
Exon primers |
5'→3' |
Tm (°C) |
extension time
(sec) |
Exon6- F
Exon6- R |
AAACCCACAAAGTCTACTGAGGCAC
GTTGGGCCCAGGTAGAGGAAG |
65 |
30 |
Exon8-9-F
Exon8-9- R |
TGTCGCTCATTGAACTCTCCTCC
CTTTCGTAGCTGGATTGAGAGTGG |
67 |
40 |
Exon10-11-12-F
Exon10-11-12- R |
AGTGGCCATGTGAGTGATAAG
TAAAACACAACCACCATATAGCC |
59 |
40 |
Exon13- F
Exon13- R |
ATGGCAGAGCAGTGTGGAATAC
GTGGCTCTCAGGCTTTTCTCTC |
63 |
40 |
Exon14- F
Exon14- R |
GGTGTCTTGTTTCCTGTCTGAG
TAGGAGAGAAGGACATGGTGAG |
61 |
30 |
F: Forward, R: Reverse
Polymerase Chain Reaction and Sequencing
DNA was extracted from whole blood using proteinase
K-phenol-chloroform method. Eight exons (6,8,9,10,11,12,13,14) of ATP7B gene
were amplified by PCR in a 25µl reaction (H2O 19.4µl, dNTP 10mMol 0.5µl, MgCl2
50mMol 0.75µl, 0.3µl of 12.5pMol primers (as listed in table 1), and Taq DNA
polymerase 1unit). Amplification was performed in a three step reaction for 40
cycles (for exons 6 and 14) and 45 cycles for the other exons, 95°C 30s, 72°C
30s, 95°C 5min, and 72°C 10min as initial denaturation and final extension.
Bi-directional sequencing was performed using the ABI
3130xl, Genetic analyzer (
To assess the possibility that the novel mutations
detected in this study might be polymorphisms that do not alter the function of
the gene, we tested 50 control chromosomes in our population. We have classified
sequence changes in the WD gene as polymorphisms if they do not modify the amino
acid sequence of the protein product or result in nonconservative changes in
nonessential residues of the protein or are detected in normal chromosomes of
the same population (control group) or in chromosomes with defined disease
causing mutation.
Mutations are named according to the guidelines from
http://www.HGMD.org/, using the reference sequence with the GenBank accession
number NM_00053.1. The nucleotide +1 is the A of the ATG translation initiation
codon. The ATG translation initiation codon is also the first codon.
RESULTS
We screened 70 WD patients from 54 unrelated families
for nucleotide variants in seven exons of the ATP7B gene. The study population
included 40 males and 30 females with their age ranged 5-40 years.
Of 70 patients, 18 (25.7%) had at least one mutation,
while 52 patients failed to show any mutation in the studied exons. Altogether,
12 different mutations including 9 missense and 3 deletion (one of which is
nonsense) have been found. According to the literature and the “
Totally, 15 (21.4%) patients were homozygous, one
(1.4%) was compound heterozygous with different mutations identified on both
alleles and 2 (2.9%) were compound heterozygous for whom the second mutation was
not identified. The most common mutation is H1069Q point mutation, presents in 4
of 70 patients (5.7%), all of whom are homozygous. Table 2 summarizes the
various identified genotypes and the corresponding age at disease onset,
presence of KF ring plus the involved organ liver, brain or both.
Interestingly, D642H mutation has been detected in one
family which leads to both hepatic and mixed Wilson's disease presentations. In
the heterozygous form of this mutation, our patients were two sisters with
hepatic WD, and their brother who was homozygous for D642H and presented with
rather neurological WD.
Table 2.
Characteristics of 27 Iranian patients with Wilson’s disease with ATP7B
mutations
Mutation |
Nucleotide
change |
Type |
Exon |
Domain |
Manifestation |
KFR
(+/-) |
Age at onset of symptoms (yrs) |
|
Homozygotes |
|
|
|
|
|
|
|
|
1639delAT |
1639delAT |
|
Deletion |
6 |
Between CuBD and TM |
H |
+ |
9 |
D642H |
D642H |
1924G>C |
Missense |
6 |
Cu6/TM1 |
H/N |
- |
16 |
T778I |
T778I |
2363C>T |
Missense |
9 |
TM4 |
N |
+ |
28 |
T778I |
T778I |
2363C>T |
Missense |
9 |
TM4 |
H |
+ |
23 |
P840L |
P840L |
2519C>T |
Missense |
10 |
TD |
H |
? |
25 |
2532delA |
2532delA |
|
Deletion |
10 |
TD |
H |
+ |
9 |
V890M |
V890M |
2668G>A |
Missense |
11 |
TD/TM5 |
H |
- |
19 |
H1069Q |
H1069Q |
3207C>A |
Missense |
14 |
ATP loop |
|||
A874V |
A874V |
2621C>T |
Missense |
11 |
TD |
H |
- |
12 |
A874V |
A874V |
2621C>T |
Missense |
11 |
TD |
H |
- |
14 |
2803-2805
ACG>-TG |
2803-2805
ACG>-TG |
|
Nonsense |
11 |
TD |
H |
+ |
21 |
H1069N |
H1069N |
3205C>A |
Missense |
14 |
ATP loop |
H/N |
+ |
19 |
H1069Q |
H1069Q |
3207C>A |
Missense |
14 |
ATP loop |
H |
+ |
17 |
H1069Q |
H1069Q |
3207C>A |
Missense |
14 |
ATP loop |
H |
+ |
18 |
H1069Q |
H1069Q |
3207C>A |
Missense |
14 |
ATP loop |
H |
+ |
18 |
Compound heterozygote |
||||||||
R778L |
R969Q |
2333G>T/2906G>A |
Missense/ Missense |
8/13 |
TM4/TM6 |
H |
? |
22 |
Compound heterozygote (second mutation not
yet identified) |
||||||||
D642H |
? |
1924G>C |
Missense |
6 |
Cu6/TM1 |
H |
- |
14 |
D642H |
? |
1924G>C |
Missense |
6 |
Cu6/TM1 |
H |
- |
21 |
H:
Hepatic, N: Neurologic, CuBD: Copper biding domain, TM: Transmembrane Domain,
TD: Transduction Domain
Table 3.
Comparison of the observed polymorphisms in
WD
patients and controls
SNP |
exons |
Frequency
in cases |
Frequency in
controls |
A2495G (K831R) |
10 |
0.31 |
0.38 |
G2855A (K952R) |
12 |
0.26 |
0.31 |
G3009A (A1003A) |
13 |
0.1 |
0.15 |
G2973A (T991T) |
13 |
0.05 |
0.08 |
Exon 14 has been identified as a
hot spot for mutations. We detected two disease causing mutations in this exon,
one of which was novel. Totally, 4 patients revealed to have H1069Q, of whom one
has another disease causing mutation (V890M) in exon 11. Surprisingly, all of
these patients presented with hepatic involvement. H1069N mutation was detected
in a 19-year old girl, presented with acute hepatic failure and neurological
manifestations.
One of
the novel deletions found in this study involved one nucleotide in exon 10
(2532delA). It occurred in a 9-year old boy presented with hepatic failure.
2803-2805ACG>-TG mutation was detected in a member of a relatively large family.
Homozygous patient had hepatic WD and we could not detect any neurological signs
in the affected patient.
In
addition to 12 different mutations, 4 different sequence variations with no
clinical significance were identified (table 3). These variants have been
defined in previous studies as a polymorphism detected in a normal population or
not altering the amino acid composition in the protein.
DISCUSSION
Wilson's
disease is an autosomal recessive disorder, which is generally described by
recurrence fulminant hepatitis and chronic liver cirrhosis (15). In most of the
cases, neurological symptoms, including depression, Parkinson symptom,
pseudosclerosis, distonia and akinetic rigid syndrome will be appeared in the
third decade of life (16-18).
This
study was our preliminary attempt to describe the mutation spectrum of seven
exons of ATP7B gene among Iranian population. Besides, the data presented herein
point out the prevalence of the mutations and their associated phenotype. Our
study is being continued to evaluate all other exons of ATP7B gene.
We found
12 different mutations, including 4 novel disease causing mutations, in 18
individuals out of 70 referred patients. In the rest of the patients we could
not detect any mutation in these exons, however, they may have mutations in
other exons. Also we identified several amino acid changes or non-change
mutation that were defined as the single nucleotide polymorphisms (SNP) due to
their high prevalence in either healthy populations or patients. We used them as
the polymorphic markers to confirm our results and perform the segregation
analysis of ATP7B mutation screening in the patients.
Exon 14
has been introduced as a hot spot for mutations; we detected three different
mutations in this exon, of which 2 were novel. H1069Q, located in exon14, is the
most frequent mutation in ATP7B gene responsible for WD in US, and central
European population (19,20). We observed this mutation in four patients all of
whom had only hepatic presentation and aged 5 to 40 years. Moreover, we found a
novel causative mutation, H1069N. We screened 50 unrelated individuals for those
mutations and none of the tested subjects were heterozygote or homozygote.
H1069N mutation has been occurred in a conserved region. Alteration happens in
non-polar amino acid “histidin” to hydrophilic “asparagines” within the highly
conserved SEHPL domain that is highly deleterious (21-23).
2803-2805ACG>-TG mutation was detected in a relatively large family. Homozygous
patients had hepatic WD and we could not detect any neurological signs in these
patients. However, with a quick glimpse to all observed phenotype presented by
frameshift mutations in our patients, we can confirm the role of recognized
frameshift mutations, 1639delC and 2803-2805ACG>-TG in presentation of hepatic
signs of WD without any neurological symptoms.
Mutations in exon 6 of WND gene, including 1639delAT and D642H, result to WD in
either heterozygous or homozygous state. We can explain this debate through the
previously described predominant effect of causative mutations in exon6 of ATP7B
gene. D642H was observed in 3 siblings of one family. Two sisters with
heterozygous mutation had hepatic WD, and their brother who was homozygous for
the so-called mutation had mixed phenotype including liver involvement in
addition to neurological symptoms.
R778L is
one of the most prevalent mutations in Eastern Asian countries, as reported in
Chinese, Korean, Japanese, and Hungarian and leads to liver involvement in WD
patients. We found this mutation in the compound heterozygous state with R969Q
in one patient who had hepatic failure. It represents the mixed ethnic
background of Iranian population.
Needless
to say, analysis of other ATP7B exons should be carried out in order to draw a
better conclusion.
REFERENCES
1.
Scheinberg IH, Sternlieb I.
2.
Wilson
FP. A preliminary study of the biochemical relations of various
lipoid substances in the liver.
Biochem
J 1912;6(1):100-5.
3.
Eisenbach C,
Sieg O,
Stremmel
W, et al. Diagnostic criteria for acute liver failure due to
4.
Das SK,
Ray K.
Wilson's disease: an update.
Nat Clin
Pract Neurol 2006;2(9):482-93.
5.
Das M,
Misra UK,
Kalita J.
A study of clinical, MRI and multimodality evoked potentials in neurologic
6.
Ferenci
P,
Czlonkowska A,
Merle U,
et al. Late-onset Wilson's disease.
Gastroenterology 2007;132(4):1294-8.
7.
Nagao K.
What's your diagnosis?
8.
Tanner MS.
Disorders of copper metabolism. In: Kelly DA, editor. Diseases of the liver and
biliary system in children.
9.
Twomey
PJ,
Viljoen
A,
House IM,
et al. Copper: ceruloplasmin ratio.
J Clin
Pathol 2007;60(4):441-2.
10.
Bull PC,
Barwell JA, Hannah HT, et al. Isolation of new probes in the region
of the
11.
Bull PC,
Cox DW. Long range restriction mapping of 13q14.3 focused on the
Genomics 1993;16(3):593-8.
12.
Bull PC, Thomas
GR, Rommens JM, et al. The
13.
Hsi G,
Cox DW. A comparison of the mutation spectra of Menkes disease and
14.
Kim EK,
Yoo OJ, Song KY, et al. Identification of three novel mutations and a
high frequency of the Arg778Leu mutation in Korean patients with Wilson disease.
Hum Mutat 1998;11(4):275-8.
15.
Cox, Roberts EA.
Wilson disease. In: Feldman M, Friedman LS, Sleisenger MH, editors. Sleisenger
and Forstran’s gastrointestinal and liver disease: pathophysiology/diagnosis/management.
7th edition. Saunders,
16.
Ferenci
P, Czlonkowska A, Merle U, et al. Late-onset Wilson's disease.
Gastroenterology 2007;132(4):1294-8.
17.
Czlonkowska A, Tarnacka B, Moller JC, et al. Unified Wilson's disease
rating scale; a proposal for the neurological scoring of Wilson's disease
patients. Neurol Neurochir Pol 2007;41(1):1-12.
18.
Takeshita Y,
19.
Panagiotakaki E,
Tzetis M, Manolaki N, et al. Genotype-phenotype correlations for a wide spectrum
of mutations in the Wilson disease gene (ATP7B). Am J Med Genet
2004;131A:168-73.
20.
21.
Gromadzka G,
Schmidt
HH,
Genschel
J, et al. H1069Q mutation in ATP7B and biochemical parameters of
copper metabolism and clinical manifestation of Wilson's disease.
Mov
Disord 2006;21(2):245-8.
22.
Tsivkovskii R, Efremov RG, Lutsenko S. The role of the invariant
His-1069 in folding and function of the Wilson's disease protein, the human
copper-transporting ATPase ATP7B. J Biol Chem 2003;278(15):13302-8.